Recombinant:
Article Title: CSF-contacting neurons respond to Streptococcus pneumoniae and promote host survival during central nervous system infection.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli DH5⍺ ATCC N/A Listeria monocytogenes LL195 Weinmaier et al.75 N/A Sindbis virus Hernandez et al.76 N/A Streptococcus pneumoniae D39V: serotype 2 Avery et al.77 and Slager et al.78 N/A Streptococcus pneumoniae D39V hlpA-GFP camr Kjos et al.79 N/A Streptococcus pneumoniae D39V hlpA_hlpA-mCherry camr Beilharz et al.80 N/A Chemicals, peptides, and recombinant proteins 2-butanone Sigma-Aldrich Cat#W217012 2-methylpropanal Sigma-Aldrich Cat#W222003 2-pentanone Sigma-Aldrich Cat#W284220 ⍺-bungarotoxin Tocris Biosciences Cat#2133 m-Slide 8 Well ibidi Cat#80826 Acetone Sigma-Aldrich Cat#534064 B27 Supplement Thermo Fisher Scientific Cat17504044 Bacto Brain Heart Infusion Becton, Dickinson and Company Cat#237500 C+Y medium Martin et al.81 N/A CaCl2 Sigma-Aldrich Cat#C3306 CaCl2 Sigma-Aldrich Cat#223506 Columbia agar, 5% v/v defibrinated sheep blood bioM erieux Cat#43049 Columbia Agar Base Thermo Fisher Scientific Cat# R452954 FBS Thermo Fisher Scientific Cat#10270106 Defibrinated Sheep Blood bioTRADING Cat#BTSG100 Dextran, Alexa Fluor 647; 10,000 MW, Anionic, Fixable Invitrogen Cat#D22914 Dimethyl disulfide (DMDS) Sigma-Aldrich Cat#W353604 DMEM Thermo Fisher Scientific Cat#10938025 DMSO Sigma-Aldrich Cat#D8418 Ethyl 3-aminobenzoate methanesulfonate Sigma-Aldrich Cat#A5040 Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma-Aldrich Cat#E5134 FACSMax Buffer AMC Biotechnology Cat#T200100 Gibco Human GDNF Recombinant Protein Fisher Scientific Cat#10679963 Glass beads 1.0mm Sigma-Aldrich Cat#Z250473 D-(+)-Glucose Sigma-Aldrich Cat#G8769 D-(+)-Glucose Sigma-Aldrich Cat#G8270 HBSS Fisher Scientific Cat#14170088 HEPES Sigma-Aldrich Cat#H3375 KCl Sigma-Aldrich Cat#P9333 L-cysteine Sigma-Aldrich Cat#30089 L-glutamine Thermo Fisher Scientific Cat#25030024 Metronidazole Sigma-Aldrich Cat#M3761 MgCl2 Sigma-Aldrich Cat#M2670 N2 Supplement Thermo Fisher Scientific Cat#17502048 Na2HPO4 Sigma-Aldrich Cat#5136 NaCl Sigma-Aldrich Cat#S7653 NaH2PO4 Sigma-Aldrich Cat#4269 (Continued on next page) Current Biology 33, 940–956.e1–e10, March 13, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER scg2a F2 - AAATTTATCCGGATTAGTGTAGACATG This paper N/A scg2a R2 - ATAAGAAACGGGTTCAGTTCCACTAAG This paper N/A nppc F1 - TGTTGATTTTAAGTCATAGGCTACATG This paper N/A nppc R1 - TTAAAGCAGCTTTTCTTTTTAACACTG This paper N/A nppc F2 - GAGAGGTTGTTAATGGAGTGGTAG This paper N/A nppc R2 - TAGAGTGAATCCAGAGTCATTATGAAG This paper N/A esm1 F1 - ATAATCATCCTCATCCTTGTAGAAGTC This paper N/A esm1 R1 - CTTCATTCACTGTCACATCCAAGGAG This paper N/A tas2r3 F1 - TAATGTTTTACTGTGGTCACTTATTGG This paper N/A tas2r3 R1 - AAACACAACCTCGAATAGACATATATG This paper N/A scg2a crRNA1 - GCTGGGAGGAGGGCGCAATT This paper N/A scg2a crRNA2 - TCATCTCGATGCTGCGCAGC This paper N/A nppc crRNA1 - CAGCAAATGCGAGATGATCA This paper N/A nppc crRNA2 - ACACTCGGGCACGGGGCCCC This paper N/A esm1 crRNA1 - GACTGAGGCGTGGGGTCCCG This paper N/A esm1 crRNA2 - GCAGTGCTCACCCCGTCCCG This paper N/A tas2r3 crRNA1 - ATGACTGAAATTCCTGCAGC This paper N/A tas2r3 crRNA2 - TCCAGACCAAAAACGGCCAC This paper N/A Software and algorithms Illustrator Adobe https://www.adobe.com/ ImageJ Schneider et al.84 https://imagej.nih.gov/ij MATLAB Mathworks N/A Prism 7.0 GraphPad https://www.graphpad.com/ Other Gemma Micro 500 Skretting N/A ll OPEN ACCESSArticle
Article Title: A genetically targeted ion sensor reveals distinct seizure-related chloride and pH dynamics in GABAergic interneuron populations
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains AAV8-EF1a-double floxed-ClopHensorN-WPRE-HGHpA The Vector Core at the University of North Carolina at Chapel Hill ( UNC Vector Core ) AAV custom production using this paper’s floxed ClopHensorN plasmid made available on Addgene Cat#193728 Chemicals, Peptides, and Recombinant Proteins Earle’s Balanced Salt Solution with CaCl 2 and MgSO 4 Thermo Fisher Scientific Cat#24010043 Millicell-CM membranes Sigma-Aldrich (USA) Cat#PICM03050 Minimum Essential Media with GlutaMAX-I Thermo Fisher Scientific Cat#41090036 Heat-inactivated horse serum Thermo Fisher Scientific Cat#26050088 B27 supplement Thermo Fisher Scientific Cat17504044 Nigericin Sigma-Aldrich (USA) Cat#N7143 Tributyltin chloride Sigma-Aldrich (USA) Cat# T50202 Chloride ionophore I Sigma-Aldrich (USA) Cat#99408-0.1 ML-F Experimental Models: Cell Lines HEK293 cells Sigma-Aldrich (USA) Cat#85120602 Experimental Models: Organisms/Strains Mouse: PV-Cre: B6; 129P2-Pvalb tm1(cre)Arbr /J The Jackson Laboratory (USA) RRID:IMSR_JAX:008069 Mouse: SST-IRES-Cre: Sst tm2.1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:013044 Mouse: VIP-IRES-Cre: Vip tm1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:010908 Mouse: CamK2a-Cre: Tg(Camk2a-cre)T29-1Stl/J The Jackson Laboratory (USA) RRID:IMSR_JAX:005359 Mouse: C57BL/6J: C57BL/6J The Jackson Laboratory (USA) RRID:IMSR_JAX:000664 Recombinant DNA ClopHensorN plasmid Addgene Cat#50758 floxed ClopHensorN plasmid Addgene Cat#193728 Software and Algorithms MATLAB Mathworks (USA) R2017b GraphPad Prism GraphPad Software (USA) v6.01 CorelDraw Corel Corporation (USA) X6 Open in a separate window Key resources table . ..
Article Title: Organoid modeling of human fetal lung alveolar development reveals mechanisms of cell fate patterning and neonatal respiratory disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit monoclonal anti-GATA6 Cell Signaling Technology Cat# 5851, RRID:AB_10705521 Rabbit polyclonal anti-NOTUM Novus Biological Cat# NBP2-94699, RRID:N/A Mouse monoclonal anti-KI67 BD Biosciences Cat# 550609, RRID:AB_393778 Mouse monoclonal anti-GAPDH Abcam Cat# ab8245, RRID:AB_2107448 Normal Rabbit IgG Cell Signaling Technology Cat# 2729, RRID:AB_1031062 Biological samples Organoid lines: HDBR 13393, 13567, 14387, 14404, 14459, 14556, 14598, 14630, 14643, 14644, 14906, 14996, 14998 HDBR London and Newcastle N/A Organoid lines: BRC 1915, 1938, 1943 Brain Repair Center, University of Cambridge N/A Chemicals, peptides, and recombinant proteins ActinGreen 488 ReadyProbes Reagent Thermo Fisher Scientific Cat# R37110 2,20-Thiodiethanol (TDE) Merck Cat# 166782 ABC99 Cambridge Bioscience Cat# CAY25858 ActivX TAMRA-FP Serine Hydrolase Probe Thermo Fisher Scientific Cat# 88318 M-PER Mammalian Protein Extraction Reagent Thermo Fisher Scientific Cat# 78503 Halt Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78420 N2 supplement Thermo Fisher Scientific Cat#17502001 B27 supplement Thermo Fisher Scientific Cat12587001 N-acetylcysteine Merck Cat#A9165 EGF PeproTech Cat#AF-100-15 FGF10 PeproTech Cat#100-26 FGF7 PeproTech Cat#100-19 Noggin PeproTech Cat#120-10C R-spondin Stem Cell Institute, University of Cambridge N/A CHIR99021 Stem Cell Institute, University of Cambridge N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 BMP4 Peprotech Cat# 120-05 TGF-b1 Peprotech Cat# 100-21 8-Bromoadenosine 3’5’-cyclic monophosphate (cAMP) Merck Cat# B5386 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 Y-27632 Merck Cat# 688000 Dexamethasone (Dex) Merck Cat# D4902 DAPT Merck Cat# D5942 Doxycycline (Dox) Merck Cat# D9891 Trimethoprim (TMP) Merck Cat# 92131 Collagenase Merck Cat# C9891 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 RBC lysis buffer BioLegend Cat# 420301 Cell Recovery Solution Corning Cat# 354253 Collagen Merck Cat# CLS3493 Micrococcal Nuclease (MNase) Cell Signaling Technology Cat# 10011S RIPA buffer Merck Cat# R0278 (Continued on next page) Cell Stem Cell 30, 20–37.e1–e9, January 5, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays CD326 (EpCAM) MicroBeads, human Miltenyi Biotec Cat# 130-061-101 In-Fusion HD Cloning Plus Takara Cat# 638909 RNeasy Mini Kit Qiagen Cat# 74004 PicoPure RNA Isolation Kit Thermo Fisher Scientific Cat# KIT0204 SimpleChIP Chromatin immunoprecipitation kit Cell Signaling Technology Cat# 9002 Chromium Single Cell V(D)J Kits (v1) 10X N/A Deposited data Bulk RNA-seq, ATAC-seq, DamID-seq of organoids NCBI’s GEO GSE178529 scRNA-seq of human fetal lungs ArrayExpress7 E-MTAB-11278 scRNA-seq of lung organoids ArrayExpress E-MTAB-11435 Oligonucleotides gRNA-NKX2.1_1: 5’-GTCTGACGGCGGCAGAAGAG-3’ Horlbeck et al.34 N/A gRNA-NKX2.1_2: 5’-GGACCAACAGTGCGGCCCCA-3’ Horlbeck et al.34 N/A gRNA-NKX2.1_2: 5’-GAAATGAGCGAGCGAGTCTG-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_1: 5’-GGCGGTCTTGACACTCGCGG-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_2: 5’-GTCGCCAGGACACACTGTTC-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_3: 5’-GGTCACTGGACACGCATCGG-3’ Horlbeck et al.34 N/A Recombinant DNA pLenti-hSPC-eGFP-EF1a-TagRFP This paper N/A pLenti-tetON-KRAB-dCas9-DHFR-EF1aTagRFP-2A-tet3G Sun et al.5 Addgene: #167935, RRID:Addgene_167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.5 Addgene: #167936, RRID:Addgene_167936 pLenti-tetON-NKX2-1-EF1a-TagRFP2A-tet3G Sun et al.5 Addgene: #167942; RRID:Addgene_167942 pLenti-tetON-NKX2-1-delDBD-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-R162del-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-Q175*-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-R178*-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-I207F -EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-I207M -EF1aTagRFP-2A-tet3G This paper N/A pLenti-SFFV-mNG-Dam-NKX2.1 This paper N/A pLenti-tetON-TFAP2C-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-NOTUM-EF1a-TagRFP2A-tet3G This paper N/A (Continued on next page) e3 Cell Stem Cell 30, 20–37.e1–e9, January 5, 2023
Article Title: The Wnt/TCF7L1 transcriptional repressor axis drives primitive endoderm formation by antagonizing naive and formative pluripotency
Article Snippet: R35-95 (RUO) BD Biosciences Cat#553930, RRID:AB_479719 APC Rat IgG2α, κ Isotype (eBR2a) Thermo Fisher Scientific Cat#17-4321-81, RRID:AB_470181 Supplementary Table 2: Reagents and resources .. XAV939 Sigma Aldrich Cat#X3004 PD0325901 Sigma Aldrich Cat#PZ0162 CHIR99021 Sigma Aldrich Cat#SML1046 Retinoic acid Sigma Aldrich Cat#R2625 iCRT3 Sigma Aldrich Cat#SML0211 Doxycycline (Dox) Sigma Aldrich Cat#D9891 Phosphatase inhibitor Cocktail 2 Sigma Aldrich Cat# P5726 Phosphatase inhibitor Cocktail 3 Sigma Aldrich Cat# P0044 Protease inhibitor cocktail Sigma Aldrich Cat# P8340 Recombinant Murine LIF Peprotech Cat#250-02 Recombinant Human/Murine/Rat Activin A Peprotech Cat#120-14E Recombinant Human FGF-basic Peprotech Cat#100-18B Recombinant Human DKK-1 Peprotech Cat#120-30 Chorionic gonadotropin human Sigma Aldrich Cat#CG10-1VL Cook Blasto Cook Ireland Ltd, Ireland Cat# G46296 N2 Supplement Thermo Fisher Scientific Cat#17502048 B27 Supplement Thermo Fisher Scientific Cat12587010 Neurobasal Gibco Cat#21103-049 DMEM/F12 Gibco Cat#11320-074 DMEM Gibco Cat#41965–039 Knockout DMEM Gibco Cat#10829-018 Knockout serum replacement Gibco Cat#10828-028 Normal Donkey serum Jackson ImmunoResearch Cat#017-000-121, RRID:AB_2337258 Human Plasma Fibronectin Millipore Cat#FC010 EmbryoMax 0.1% Gelatin Solution Sigma Aldrich Cat#ES-006-B Accutase solution Sigma Aldrich Cat#A6964 Trypsin 0.05% Gibco Cat#25300-054 Cell Dissociation Solution Sigma Aldrich Cat#C5914 EmbryoMax® M2 Medium Sigma Aldrich Cat#MR-015-D EmbryoMax® KSOM Mouse Embryo Media Sigma Aldrich Cat#MR-121-D RIPA buffer Sigma Aldrich Cat#R0278 .. GenEluteTM Mammalian Total RNA Miniprep Kit Sigma Aldrich Cat#RTN350 On-Column DNase I Digestion Set Sigma Aldrich Cat#DNASE70 iScriptTM cDNA Synthesis Kit Bio-Rad Cat#1708890 Arcturus® PicoPure® DNA Extraction Kit Thermo Fisher Scientific Cat#KIT0103 KAPA Stranded RNA-Seq Library Preparation Kit Illumina® Platforms Roche Cat#7962207001 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#Q32854
Modification:
Reverse Transcription:
SYBR Green Assay:
Virus:Article Title: CSF-contacting neurons respond to Streptococcus pneumoniae and promote host survival during central nervous system infection.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli DH5⍺ ATCC N/A Listeria monocytogenes LL195 Weinmaier et al.75 N/A Sindbis virus Hernandez et al.76 N/A Streptococcus pneumoniae D39V: serotype 2 Avery et al.77 and Slager et al.78 N/A Streptococcus pneumoniae D39V hlpA-GFP camr Kjos et al.79 N/A Streptococcus pneumoniae D39V hlpA_hlpA-mCherry camr Beilharz et al.80 N/A Chemicals, peptides, and recombinant proteins 2-butanone Sigma-Aldrich Cat#W217012 2-methylpropanal Sigma-Aldrich Cat#W222003 2-pentanone Sigma-Aldrich Cat#W284220 ⍺-bungarotoxin Tocris Biosciences Cat#2133 m-Slide 8 Well ibidi Cat#80826 Acetone Sigma-Aldrich Cat#534064 B27 Supplement Thermo Fisher Scientific Cat17504044 Bacto Brain Heart Infusion Becton, Dickinson and Company Cat#237500 C+Y medium Martin et al.81 N/A CaCl2 Sigma-Aldrich Cat#C3306 CaCl2 Sigma-Aldrich Cat#223506 Columbia agar, 5% v/v defibrinated sheep blood bioM erieux Cat#43049 Columbia Agar Base Thermo Fisher Scientific Cat# R452954 FBS Thermo Fisher Scientific Cat#10270106 Defibrinated Sheep Blood bioTRADING Cat#BTSG100 Dextran, Alexa Fluor 647; 10,000 MW, Anionic, Fixable Invitrogen Cat#D22914 Dimethyl disulfide (DMDS) Sigma-Aldrich Cat#W353604 DMEM Thermo Fisher Scientific Cat#10938025 DMSO Sigma-Aldrich Cat#D8418 Ethyl 3-aminobenzoate methanesulfonate Sigma-Aldrich Cat#A5040 Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) Sigma-Aldrich Cat#E5134 FACSMax Buffer AMC Biotechnology Cat#T200100 Gibco Human GDNF Recombinant Protein Fisher Scientific Cat#10679963 Glass beads 1.0mm Sigma-Aldrich Cat#Z250473 D-(+)-Glucose Sigma-Aldrich Cat#G8769 D-(+)-Glucose Sigma-Aldrich Cat#G8270 HBSS Fisher Scientific Cat#14170088 HEPES Sigma-Aldrich Cat#H3375 KCl Sigma-Aldrich Cat#P9333 L-cysteine Sigma-Aldrich Cat#30089 L-glutamine Thermo Fisher Scientific Cat#25030024 Metronidazole Sigma-Aldrich Cat#M3761 MgCl2 Sigma-Aldrich Cat#M2670 N2 Supplement Thermo Fisher Scientific Cat#17502048 Na2HPO4 Sigma-Aldrich Cat#5136 NaCl Sigma-Aldrich Cat#S7653 NaH2PO4 Sigma-Aldrich Cat#4269 (Continued on next page) Current Biology 33, 940–956.e1–e10, March 13, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER scg2a F2 - AAATTTATCCGGATTAGTGTAGACATG This paper N/A scg2a R2 - ATAAGAAACGGGTTCAGTTCCACTAAG This paper N/A nppc F1 - TGTTGATTTTAAGTCATAGGCTACATG This paper N/A nppc R1 - TTAAAGCAGCTTTTCTTTTTAACACTG This paper N/A nppc F2 - GAGAGGTTGTTAATGGAGTGGTAG This paper N/A nppc R2 - TAGAGTGAATCCAGAGTCATTATGAAG This paper N/A esm1 F1 - ATAATCATCCTCATCCTTGTAGAAGTC This paper N/A esm1 R1 - CTTCATTCACTGTCACATCCAAGGAG This paper N/A tas2r3 F1 - TAATGTTTTACTGTGGTCACTTATTGG This paper N/A tas2r3 R1 - AAACACAACCTCGAATAGACATATATG This paper N/A scg2a crRNA1 - GCTGGGAGGAGGGCGCAATT This paper N/A scg2a crRNA2 - TCATCTCGATGCTGCGCAGC This paper N/A nppc crRNA1 - CAGCAAATGCGAGATGATCA This paper N/A nppc crRNA2 - ACACTCGGGCACGGGGCCCC This paper N/A esm1 crRNA1 - GACTGAGGCGTGGGGTCCCG This paper N/A esm1 crRNA2 - GCAGTGCTCACCCCGTCCCG This paper N/A tas2r3 crRNA1 - ATGACTGAAATTCCTGCAGC This paper N/A tas2r3 crRNA2 - TCCAGACCAAAAACGGCCAC This paper N/A Software and algorithms Illustrator Adobe https://www.adobe.com/ ImageJ Schneider et al.84 https://imagej.nih.gov/ij MATLAB Mathworks N/A Prism 7.0 GraphPad https://www.graphpad.com/ Other Gemma Micro 500 Skretting N/A ll OPEN ACCESSArticle
Article Title: A genetically targeted ion sensor reveals distinct seizure-related chloride and pH dynamics in GABAergic interneuron populations
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains AAV8-EF1a-double floxed-ClopHensorN-WPRE-HGHpA The Vector Core at the University of North Carolina at Chapel Hill ( UNC Vector Core ) AAV custom production using this paper’s floxed ClopHensorN plasmid made available on Addgene Cat#193728 Chemicals, Peptides, and Recombinant Proteins Earle’s Balanced Salt Solution with CaCl 2 and MgSO 4 Thermo Fisher Scientific Cat#24010043 Millicell-CM membranes Sigma-Aldrich (USA) Cat#PICM03050 Minimum Essential Media with GlutaMAX-I Thermo Fisher Scientific Cat#41090036 Heat-inactivated horse serum Thermo Fisher Scientific Cat#26050088 B27 supplement Thermo Fisher Scientific Cat17504044 Nigericin Sigma-Aldrich (USA) Cat#N7143 Tributyltin chloride Sigma-Aldrich (USA) Cat# T50202 Chloride ionophore I Sigma-Aldrich (USA) Cat#99408-0.1 ML-F Experimental Models: Cell Lines HEK293 cells Sigma-Aldrich (USA) Cat#85120602 Experimental Models: Organisms/Strains Mouse: PV-Cre: B6; 129P2-Pvalb tm1(cre)Arbr /J The Jackson Laboratory (USA) RRID:IMSR_JAX:008069 Mouse: SST-IRES-Cre: Sst tm2.1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:013044 Mouse: VIP-IRES-Cre: Vip tm1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:010908 Mouse: CamK2a-Cre: Tg(Camk2a-cre)T29-1Stl/J The Jackson Laboratory (USA) RRID:IMSR_JAX:005359 Mouse: C57BL/6J: C57BL/6J The Jackson Laboratory (USA) RRID:IMSR_JAX:000664 Recombinant DNA ClopHensorN plasmid Addgene Cat#50758 floxed ClopHensorN plasmid Addgene Cat#193728 Software and Algorithms MATLAB Mathworks (USA) R2017b GraphPad Prism GraphPad Software (USA) v6.01 CorelDraw Corel Corporation (USA) X6 Open in a separate window Key resources table . ..
Bioprocessing:Article Title: A genetically targeted ion sensor reveals distinct seizure-related chloride and pH dynamics in GABAergic interneuron populations
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains AAV8-EF1a-double floxed-ClopHensorN-WPRE-HGHpA The Vector Core at the University of North Carolina at Chapel Hill ( UNC Vector Core ) AAV custom production using this paper’s floxed ClopHensorN plasmid made available on Addgene Cat#193728 Chemicals, Peptides, and Recombinant Proteins Earle’s Balanced Salt Solution with CaCl 2 and MgSO 4 Thermo Fisher Scientific Cat#24010043 Millicell-CM membranes Sigma-Aldrich (USA) Cat#PICM03050 Minimum Essential Media with GlutaMAX-I Thermo Fisher Scientific Cat#41090036 Heat-inactivated horse serum Thermo Fisher Scientific Cat#26050088 B27 supplement Thermo Fisher Scientific Cat17504044 Nigericin Sigma-Aldrich (USA) Cat#N7143 Tributyltin chloride Sigma-Aldrich (USA) Cat# T50202 Chloride ionophore I Sigma-Aldrich (USA) Cat#99408-0.1 ML-F Experimental Models: Cell Lines HEK293 cells Sigma-Aldrich (USA) Cat#85120602 Experimental Models: Organisms/Strains Mouse: PV-Cre: B6; 129P2-Pvalb tm1(cre)Arbr /J The Jackson Laboratory (USA) RRID:IMSR_JAX:008069 Mouse: SST-IRES-Cre: Sst tm2.1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:013044 Mouse: VIP-IRES-Cre: Vip tm1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:010908 Mouse: CamK2a-Cre: Tg(Camk2a-cre)T29-1Stl/J The Jackson Laboratory (USA) RRID:IMSR_JAX:005359 Mouse: C57BL/6J: C57BL/6J The Jackson Laboratory (USA) RRID:IMSR_JAX:000664 Recombinant DNA ClopHensorN plasmid Addgene Cat#50758 floxed ClopHensorN plasmid Addgene Cat#193728 Software and Algorithms MATLAB Mathworks (USA) R2017b GraphPad Prism GraphPad Software (USA) v6.01 CorelDraw Corel Corporation (USA) X6 Open in a separate window Key resources table . ..
Plasmid Preparation:Article Title: A genetically targeted ion sensor reveals distinct seizure-related chloride and pH dynamics in GABAergic interneuron populations
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains AAV8-EF1a-double floxed-ClopHensorN-WPRE-HGHpA The Vector Core at the University of North Carolina at Chapel Hill ( UNC Vector Core ) AAV custom production using this paper’s floxed ClopHensorN plasmid made available on Addgene Cat#193728 Chemicals, Peptides, and Recombinant Proteins Earle’s Balanced Salt Solution with CaCl 2 and MgSO 4 Thermo Fisher Scientific Cat#24010043 Millicell-CM membranes Sigma-Aldrich (USA) Cat#PICM03050 Minimum Essential Media with GlutaMAX-I Thermo Fisher Scientific Cat#41090036 Heat-inactivated horse serum Thermo Fisher Scientific Cat#26050088 B27 supplement Thermo Fisher Scientific Cat17504044 Nigericin Sigma-Aldrich (USA) Cat#N7143 Tributyltin chloride Sigma-Aldrich (USA) Cat# T50202 Chloride ionophore I Sigma-Aldrich (USA) Cat#99408-0.1 ML-F Experimental Models: Cell Lines HEK293 cells Sigma-Aldrich (USA) Cat#85120602 Experimental Models: Organisms/Strains Mouse: PV-Cre: B6; 129P2-Pvalb tm1(cre)Arbr /J The Jackson Laboratory (USA) RRID:IMSR_JAX:008069 Mouse: SST-IRES-Cre: Sst tm2.1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:013044 Mouse: VIP-IRES-Cre: Vip tm1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:010908 Mouse: CamK2a-Cre: Tg(Camk2a-cre)T29-1Stl/J The Jackson Laboratory (USA) RRID:IMSR_JAX:005359 Mouse: C57BL/6J: C57BL/6J The Jackson Laboratory (USA) RRID:IMSR_JAX:000664 Recombinant DNA ClopHensorN plasmid Addgene Cat#50758 floxed ClopHensorN plasmid Addgene Cat#193728 Software and Algorithms MATLAB Mathworks (USA) R2017b GraphPad Prism GraphPad Software (USA) v6.01 CorelDraw Corel Corporation (USA) X6 Open in a separate window Key resources table . ..
Software:Article Title: A genetically targeted ion sensor reveals distinct seizure-related chloride and pH dynamics in GABAergic interneuron populations
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains AAV8-EF1a-double floxed-ClopHensorN-WPRE-HGHpA The Vector Core at the University of North Carolina at Chapel Hill ( UNC Vector Core ) AAV custom production using this paper’s floxed ClopHensorN plasmid made available on Addgene Cat#193728 Chemicals, Peptides, and Recombinant Proteins Earle’s Balanced Salt Solution with CaCl 2 and MgSO 4 Thermo Fisher Scientific Cat#24010043 Millicell-CM membranes Sigma-Aldrich (USA) Cat#PICM03050 Minimum Essential Media with GlutaMAX-I Thermo Fisher Scientific Cat#41090036 Heat-inactivated horse serum Thermo Fisher Scientific Cat#26050088 B27 supplement Thermo Fisher Scientific Cat17504044 Nigericin Sigma-Aldrich (USA) Cat#N7143 Tributyltin chloride Sigma-Aldrich (USA) Cat# T50202 Chloride ionophore I Sigma-Aldrich (USA) Cat#99408-0.1 ML-F Experimental Models: Cell Lines HEK293 cells Sigma-Aldrich (USA) Cat#85120602 Experimental Models: Organisms/Strains Mouse: PV-Cre: B6; 129P2-Pvalb tm1(cre)Arbr /J The Jackson Laboratory (USA) RRID:IMSR_JAX:008069 Mouse: SST-IRES-Cre: Sst tm2.1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:013044 Mouse: VIP-IRES-Cre: Vip tm1(cre)Zjh /J The Jackson Laboratory (USA) RRID:IMSR_JAX:010908 Mouse: CamK2a-Cre: Tg(Camk2a-cre)T29-1Stl/J The Jackson Laboratory (USA) RRID:IMSR_JAX:005359 Mouse: C57BL/6J: C57BL/6J The Jackson Laboratory (USA) RRID:IMSR_JAX:000664 Recombinant DNA ClopHensorN plasmid Addgene Cat#50758 floxed ClopHensorN plasmid Addgene Cat#193728 Software and Algorithms MATLAB Mathworks (USA) R2017b GraphPad Prism GraphPad Software (USA) v6.01 CorelDraw Corel Corporation (USA) X6 Open in a separate window Key resources table . ..
Protein Extraction:Article Title: Organoid modeling of human fetal lung alveolar development reveals mechanisms of cell fate patterning and neonatal respiratory disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit monoclonal anti-GATA6 Cell Signaling Technology Cat# 5851, RRID:AB_10705521 Rabbit polyclonal anti-NOTUM Novus Biological Cat# NBP2-94699, RRID:N/A Mouse monoclonal anti-KI67 BD Biosciences Cat# 550609, RRID:AB_393778 Mouse monoclonal anti-GAPDH Abcam Cat# ab8245, RRID:AB_2107448 Normal Rabbit IgG Cell Signaling Technology Cat# 2729, RRID:AB_1031062 Biological samples Organoid lines: HDBR 13393, 13567, 14387, 14404, 14459, 14556, 14598, 14630, 14643, 14644, 14906, 14996, 14998 HDBR London and Newcastle N/A Organoid lines: BRC 1915, 1938, 1943 Brain Repair Center, University of Cambridge N/A Chemicals, peptides, and recombinant proteins ActinGreen 488 ReadyProbes Reagent Thermo Fisher Scientific Cat# R37110 2,20-Thiodiethanol (TDE) Merck Cat# 166782 ABC99 Cambridge Bioscience Cat# CAY25858 ActivX TAMRA-FP Serine Hydrolase Probe Thermo Fisher Scientific Cat# 88318 M-PER Mammalian Protein Extraction Reagent Thermo Fisher Scientific Cat# 78503 Halt Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78420 N2 supplement Thermo Fisher Scientific Cat#17502001 B27 supplement Thermo Fisher Scientific Cat12587001 N-acetylcysteine Merck Cat#A9165 EGF PeproTech Cat#AF-100-15 FGF10 PeproTech Cat#100-26 FGF7 PeproTech Cat#100-19 Noggin PeproTech Cat#120-10C R-spondin Stem Cell Institute, University of Cambridge N/A CHIR99021 Stem Cell Institute, University of Cambridge N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 BMP4 Peprotech Cat# 120-05 TGF-b1 Peprotech Cat# 100-21 8-Bromoadenosine 3’5’-cyclic monophosphate (cAMP) Merck Cat# B5386 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 Y-27632 Merck Cat# 688000 Dexamethasone (Dex) Merck Cat# D4902 DAPT Merck Cat# D5942 Doxycycline (Dox) Merck Cat# D9891 Trimethoprim (TMP) Merck Cat# 92131 Collagenase Merck Cat# C9891 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 RBC lysis buffer BioLegend Cat# 420301 Cell Recovery Solution Corning Cat# 354253 Collagen Merck Cat# CLS3493 Micrococcal Nuclease (MNase) Cell Signaling Technology Cat# 10011S RIPA buffer Merck Cat# R0278 (Continued on next page) Cell Stem Cell 30, 20–37.e1–e9, January 5, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays CD326 (EpCAM) MicroBeads, human Miltenyi Biotec Cat# 130-061-101 In-Fusion HD Cloning Plus Takara Cat# 638909 RNeasy Mini Kit Qiagen Cat# 74004 PicoPure RNA Isolation Kit Thermo Fisher Scientific Cat# KIT0204 SimpleChIP Chromatin immunoprecipitation kit Cell Signaling Technology Cat# 9002 Chromium Single Cell V(D)J Kits (v1) 10X N/A Deposited data Bulk RNA-seq, ATAC-seq, DamID-seq of organoids NCBI’s GEO GSE178529 scRNA-seq of human fetal lungs ArrayExpress7 E-MTAB-11278 scRNA-seq of lung organoids ArrayExpress E-MTAB-11435 Oligonucleotides gRNA-NKX2.1_1: 5’-GTCTGACGGCGGCAGAAGAG-3’ Horlbeck et al.34 N/A gRNA-NKX2.1_2: 5’-GGACCAACAGTGCGGCCCCA-3’ Horlbeck et al.34 N/A gRNA-NKX2.1_2: 5’-GAAATGAGCGAGCGAGTCTG-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_1: 5’-GGCGGTCTTGACACTCGCGG-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_2: 5’-GTCGCCAGGACACACTGTTC-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_3: 5’-GGTCACTGGACACGCATCGG-3’ Horlbeck et al.34 N/A Recombinant DNA pLenti-hSPC-eGFP-EF1a-TagRFP This paper N/A pLenti-tetON-KRAB-dCas9-DHFR-EF1aTagRFP-2A-tet3G Sun et al.5 Addgene: #167935, RRID:Addgene_167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.5 Addgene: #167936, RRID:Addgene_167936 pLenti-tetON-NKX2-1-EF1a-TagRFP2A-tet3G Sun et al.5 Addgene: #167942; RRID:Addgene_167942 pLenti-tetON-NKX2-1-delDBD-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-R162del-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-Q175*-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-R178*-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-I207F -EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-I207M -EF1aTagRFP-2A-tet3G This paper N/A pLenti-SFFV-mNG-Dam-NKX2.1 This paper N/A pLenti-tetON-TFAP2C-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-NOTUM-EF1a-TagRFP2A-tet3G This paper N/A (Continued on next page) e3 Cell Stem Cell 30, 20–37.e1–e9, January 5, 2023
Red Blood Cell Lysis:Article Title: Organoid modeling of human fetal lung alveolar development reveals mechanisms of cell fate patterning and neonatal respiratory disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit monoclonal anti-GATA6 Cell Signaling Technology Cat# 5851, RRID:AB_10705521 Rabbit polyclonal anti-NOTUM Novus Biological Cat# NBP2-94699, RRID:N/A Mouse monoclonal anti-KI67 BD Biosciences Cat# 550609, RRID:AB_393778 Mouse monoclonal anti-GAPDH Abcam Cat# ab8245, RRID:AB_2107448 Normal Rabbit IgG Cell Signaling Technology Cat# 2729, RRID:AB_1031062 Biological samples Organoid lines: HDBR 13393, 13567, 14387, 14404, 14459, 14556, 14598, 14630, 14643, 14644, 14906, 14996, 14998 HDBR London and Newcastle N/A Organoid lines: BRC 1915, 1938, 1943 Brain Repair Center, University of Cambridge N/A Chemicals, peptides, and recombinant proteins ActinGreen 488 ReadyProbes Reagent Thermo Fisher Scientific Cat# R37110 2,20-Thiodiethanol (TDE) Merck Cat# 166782 ABC99 Cambridge Bioscience Cat# CAY25858 ActivX TAMRA-FP Serine Hydrolase Probe Thermo Fisher Scientific Cat# 88318 M-PER Mammalian Protein Extraction Reagent Thermo Fisher Scientific Cat# 78503 Halt Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78420 N2 supplement Thermo Fisher Scientific Cat#17502001 B27 supplement Thermo Fisher Scientific Cat12587001 N-acetylcysteine Merck Cat#A9165 EGF PeproTech Cat#AF-100-15 FGF10 PeproTech Cat#100-26 FGF7 PeproTech Cat#100-19 Noggin PeproTech Cat#120-10C R-spondin Stem Cell Institute, University of Cambridge N/A CHIR99021 Stem Cell Institute, University of Cambridge N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 BMP4 Peprotech Cat# 120-05 TGF-b1 Peprotech Cat# 100-21 8-Bromoadenosine 3’5’-cyclic monophosphate (cAMP) Merck Cat# B5386 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 Y-27632 Merck Cat# 688000 Dexamethasone (Dex) Merck Cat# D4902 DAPT Merck Cat# D5942 Doxycycline (Dox) Merck Cat# D9891 Trimethoprim (TMP) Merck Cat# 92131 Collagenase Merck Cat# C9891 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 RBC lysis buffer BioLegend Cat# 420301 Cell Recovery Solution Corning Cat# 354253 Collagen Merck Cat# CLS3493 Micrococcal Nuclease (MNase) Cell Signaling Technology Cat# 10011S RIPA buffer Merck Cat# R0278 (Continued on next page) Cell Stem Cell 30, 20–37.e1–e9, January 5, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays CD326 (EpCAM) MicroBeads, human Miltenyi Biotec Cat# 130-061-101 In-Fusion HD Cloning Plus Takara Cat# 638909 RNeasy Mini Kit Qiagen Cat# 74004 PicoPure RNA Isolation Kit Thermo Fisher Scientific Cat# KIT0204 SimpleChIP Chromatin immunoprecipitation kit Cell Signaling Technology Cat# 9002 Chromium Single Cell V(D)J Kits (v1) 10X N/A Deposited data Bulk RNA-seq, ATAC-seq, DamID-seq of organoids NCBI’s GEO GSE178529 scRNA-seq of human fetal lungs ArrayExpress7 E-MTAB-11278 scRNA-seq of lung organoids ArrayExpress E-MTAB-11435 Oligonucleotides gRNA-NKX2.1_1: 5’-GTCTGACGGCGGCAGAAGAG-3’ Horlbeck et al.34 N/A gRNA-NKX2.1_2: 5’-GGACCAACAGTGCGGCCCCA-3’ Horlbeck et al.34 N/A gRNA-NKX2.1_2: 5’-GAAATGAGCGAGCGAGTCTG-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_1: 5’-GGCGGTCTTGACACTCGCGG-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_2: 5’-GTCGCCAGGACACACTGTTC-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_3: 5’-GGTCACTGGACACGCATCGG-3’ Horlbeck et al.34 N/A Recombinant DNA pLenti-hSPC-eGFP-EF1a-TagRFP This paper N/A pLenti-tetON-KRAB-dCas9-DHFR-EF1aTagRFP-2A-tet3G Sun et al.5 Addgene: #167935, RRID:Addgene_167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.5 Addgene: #167936, RRID:Addgene_167936 pLenti-tetON-NKX2-1-EF1a-TagRFP2A-tet3G Sun et al.5 Addgene: #167942; RRID:Addgene_167942 pLenti-tetON-NKX2-1-delDBD-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-R162del-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-Q175*-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-R178*-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-I207F -EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-I207M -EF1aTagRFP-2A-tet3G This paper N/A pLenti-SFFV-mNG-Dam-NKX2.1 This paper N/A pLenti-tetON-TFAP2C-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-NOTUM-EF1a-TagRFP2A-tet3G This paper N/A (Continued on next page) e3 Cell Stem Cell 30, 20–37.e1–e9, January 5, 2023
Cell Recovery:Article Title: Organoid modeling of human fetal lung alveolar development reveals mechanisms of cell fate patterning and neonatal respiratory disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit monoclonal anti-GATA6 Cell Signaling Technology Cat# 5851, RRID:AB_10705521 Rabbit polyclonal anti-NOTUM Novus Biological Cat# NBP2-94699, RRID:N/A Mouse monoclonal anti-KI67 BD Biosciences Cat# 550609, RRID:AB_393778 Mouse monoclonal anti-GAPDH Abcam Cat# ab8245, RRID:AB_2107448 Normal Rabbit IgG Cell Signaling Technology Cat# 2729, RRID:AB_1031062 Biological samples Organoid lines: HDBR 13393, 13567, 14387, 14404, 14459, 14556, 14598, 14630, 14643, 14644, 14906, 14996, 14998 HDBR London and Newcastle N/A Organoid lines: BRC 1915, 1938, 1943 Brain Repair Center, University of Cambridge N/A Chemicals, peptides, and recombinant proteins ActinGreen 488 ReadyProbes Reagent Thermo Fisher Scientific Cat# R37110 2,20-Thiodiethanol (TDE) Merck Cat# 166782 ABC99 Cambridge Bioscience Cat# CAY25858 ActivX TAMRA-FP Serine Hydrolase Probe Thermo Fisher Scientific Cat# 88318 M-PER Mammalian Protein Extraction Reagent Thermo Fisher Scientific Cat# 78503 Halt Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78420 N2 supplement Thermo Fisher Scientific Cat#17502001 B27 supplement Thermo Fisher Scientific Cat12587001 N-acetylcysteine Merck Cat#A9165 EGF PeproTech Cat#AF-100-15 FGF10 PeproTech Cat#100-26 FGF7 PeproTech Cat#100-19 Noggin PeproTech Cat#120-10C R-spondin Stem Cell Institute, University of Cambridge N/A CHIR99021 Stem Cell Institute, University of Cambridge N/A SB431542 Bio-techne Cat# 1614 A83-01 Tocris Cat# 2939 BMP4 Peprotech Cat# 120-05 TGF-b1 Peprotech Cat# 100-21 8-Bromoadenosine 3’5’-cyclic monophosphate (cAMP) Merck Cat# B5386 3-Isobutyl-1-methylxanthine (IBMX) Merck Cat# I5879 Y-27632 Merck Cat# 688000 Dexamethasone (Dex) Merck Cat# D4902 DAPT Merck Cat# D5942 Doxycycline (Dox) Merck Cat# D9891 Trimethoprim (TMP) Merck Cat# 92131 Collagenase Merck Cat# C9891 Dispase Thermo Fisher Scientific Cat# 17105041 DNase Merck Cat# D4527 RBC lysis buffer BioLegend Cat# 420301 Cell Recovery Solution Corning Cat# 354253 Collagen Merck Cat# CLS3493 Micrococcal Nuclease (MNase) Cell Signaling Technology Cat# 10011S RIPA buffer Merck Cat# R0278 (Continued on next page) Cell Stem Cell 30, 20–37.e1–e9, January 5, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays CD326 (EpCAM) MicroBeads, human Miltenyi Biotec Cat# 130-061-101 In-Fusion HD Cloning Plus Takara Cat# 638909 RNeasy Mini Kit Qiagen Cat# 74004 PicoPure RNA Isolation Kit Thermo Fisher Scientific Cat# KIT0204 SimpleChIP Chromatin immunoprecipitation kit Cell Signaling Technology Cat# 9002 Chromium Single Cell V(D)J Kits (v1) 10X N/A Deposited data Bulk RNA-seq, ATAC-seq, DamID-seq of organoids NCBI’s GEO GSE178529 scRNA-seq of human fetal lungs ArrayExpress7 E-MTAB-11278 scRNA-seq of lung organoids ArrayExpress E-MTAB-11435 Oligonucleotides gRNA-NKX2.1_1: 5’-GTCTGACGGCGGCAGAAGAG-3’ Horlbeck et al.34 N/A gRNA-NKX2.1_2: 5’-GGACCAACAGTGCGGCCCCA-3’ Horlbeck et al.34 N/A gRNA-NKX2.1_2: 5’-GAAATGAGCGAGCGAGTCTG-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_1: 5’-GGCGGTCTTGACACTCGCGG-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_2: 5’-GTCGCCAGGACACACTGTTC-3’ Horlbeck et al.34 N/A gRNA-TFAP2C_3: 5’-GGTCACTGGACACGCATCGG-3’ Horlbeck et al.34 N/A Recombinant DNA pLenti-hSPC-eGFP-EF1a-TagRFP This paper N/A pLenti-tetON-KRAB-dCas9-DHFR-EF1aTagRFP-2A-tet3G Sun et al.5 Addgene: #167935, RRID:Addgene_167935 pLenti-U6-gRNA-EF1a-EGFP-CAAX Sun et al.5 Addgene: #167936, RRID:Addgene_167936 pLenti-tetON-NKX2-1-EF1a-TagRFP2A-tet3G Sun et al.5 Addgene: #167942; RRID:Addgene_167942 pLenti-tetON-NKX2-1-delDBD-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-R162del-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-Q175*-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-R178*-EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-I207F -EF1aTagRFP-2A-tet3G This paper N/A pLenti-tetON-NKX2-1-I207M -EF1aTagRFP-2A-tet3G This paper N/A pLenti-SFFV-mNG-Dam-NKX2.1 This paper N/A pLenti-tetON-TFAP2C-EF1a-TagRFP2A-tet3G This paper N/A pLenti-tetON-NOTUM-EF1a-TagRFP2A-tet3G This paper N/A (Continued on next page) e3 Cell Stem Cell 30, 20–37.e1–e9, January 5, 2023
other:Article Title: Protocol for live imaging of axonal transport in iPSC-derived iNeurons.
Article Snippet: All steps optimized for use in KOLF2.1J iPSCs Studies of human induced pluripotent stem cell (iPSC)-derived neurons promise important insights into neurodegenerative diseases.. Here, we present a protocol for live imaging of axonal transport in glutamatergic iPSC-derived neurons (iNeurons).. We describe steps for the differentiation of iPSCs into iNeurons via PiggyBac-mediated neurogenin 2 (NGN2) delivery, iNeuron culture and transfection, and the acquisition and analysis of time-lapse images.
Western Blot:Article Title: Suppression of ATM kinase signaling accelerates cellular senescence.
Article Snippet: .. B27 Supplement Thermo Fisher Scientific Cat12587-010 Bafilomycin A1 Selleck Chemicals Cat#S1413 Brain-derived neurotrophic factor (BDNF) BioLegend Cat#788904 CHIR99021 Nacalai Tesque Cat#18764-44 CultureOne Thermo Fisher Scientific Cat#A3320201 Dasatinib Selleck Chemicals Cat#S1021 DAPT Sigma-Aldrich Cat#D5942 Dibutyryl-cAMP Nacalai Tesque Cat#11540-61 Dissociation solution for human ES/iPS cells REPROCELL Cat#RCHETP002 DMEM Nacalai Tesque Cat#08458-16 DMEM/F12 Sigma-Aldrich Cat#D6421 Doxycycline Selleck Chemicals Cat#S4163 ECL Prime Western Blotting Detection Reagent Cytiva Cat#RPN2236 Fibroblast growth factor 2 (FGF2) PeproTech Cat#100-18B Fibronectin Corning Cat#356008 Fisetin Selleck Chemicals Cat#S2298 G418 Roche Cat#G418-RO Glial cell line-derived neurotrophic factor (GDNF) PeproTech Cat#450-10 Human leukemia inhibitory factor (hLIF) Nacalai Tesque Cat#NU0013-1 Inhibitor library Sigma-Aldrich Cat#BMINH02MARUN iMatrix-511 Nippi Cat#892012 KnockOut Serum Replacement Thermo Fisher Scientific Cat#10828-028 KU55933 Selleck Chemicals Cat#S1092 KU60019 Sigma-Aldrich Cat#SML1416 KU60019 Selleck Chemicals Cat#S1570 KBM neural stem cell medium Kohjin-Bio Cat#16050100 Laminin Thermo Fisher Scientific Cat#23017015 LDN-193189 Selleck Chemicals Cat#S2618 L-glutamine Sigma-Aldrich Cat#G7513 Metformin Selleck Chemicals Cat#S5958 MIRIN Cayman Chemical Cat#13208 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs Cat#E7770 NuPAGE LDS Sample Buffer Thermo Fisher Scientific Cat#NP0007 (Continued on next page) Stem Cell Reports | Vol. ..
Knock-Out:Article Title: Suppression of ATM kinase signaling accelerates cellular senescence.
Article Snippet: .. B27 Supplement Thermo Fisher Scientific Cat12587-010 Bafilomycin A1 Selleck Chemicals Cat#S1413 Brain-derived neurotrophic factor (BDNF) BioLegend Cat#788904 CHIR99021 Nacalai Tesque Cat#18764-44 CultureOne Thermo Fisher Scientific Cat#A3320201 Dasatinib Selleck Chemicals Cat#S1021 DAPT Sigma-Aldrich Cat#D5942 Dibutyryl-cAMP Nacalai Tesque Cat#11540-61 Dissociation solution for human ES/iPS cells REPROCELL Cat#RCHETP002 DMEM Nacalai Tesque Cat#08458-16 DMEM/F12 Sigma-Aldrich Cat#D6421 Doxycycline Selleck Chemicals Cat#S4163 ECL Prime Western Blotting Detection Reagent Cytiva Cat#RPN2236 Fibroblast growth factor 2 (FGF2) PeproTech Cat#100-18B Fibronectin Corning Cat#356008 Fisetin Selleck Chemicals Cat#S2298 G418 Roche Cat#G418-RO Glial cell line-derived neurotrophic factor (GDNF) PeproTech Cat#450-10 Human leukemia inhibitory factor (hLIF) Nacalai Tesque Cat#NU0013-1 Inhibitor library Sigma-Aldrich Cat#BMINH02MARUN iMatrix-511 Nippi Cat#892012 KnockOut Serum Replacement Thermo Fisher Scientific Cat#10828-028 KU55933 Selleck Chemicals Cat#S1092 KU60019 Sigma-Aldrich Cat#SML1416 KU60019 Selleck Chemicals Cat#S1570 KBM neural stem cell medium Kohjin-Bio Cat#16050100 Laminin Thermo Fisher Scientific Cat#23017015 LDN-193189 Selleck Chemicals Cat#S2618 L-glutamine Sigma-Aldrich Cat#G7513 Metformin Selleck Chemicals Cat#S5958 MIRIN Cayman Chemical Cat#13208 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs Cat#E7770 NuPAGE LDS Sample Buffer Thermo Fisher Scientific Cat#NP0007 (Continued on next page) Stem Cell Reports | Vol. ..
Article Title: The Wnt/TCF7L1 transcriptional repressor axis drives primitive endoderm formation by antagonizing naive and formative pluripotency
Article Snippet: R35-95 (RUO) BD Biosciences Cat#553930, RRID:AB_479719 APC Rat IgG2α, κ Isotype (eBR2a) Thermo Fisher Scientific Cat#17-4321-81, RRID:AB_470181 Supplementary Table 2: Reagents and resources .. XAV939 Sigma Aldrich Cat#X3004 PD0325901 Sigma Aldrich Cat#PZ0162 CHIR99021 Sigma Aldrich Cat#SML1046 Retinoic acid Sigma Aldrich Cat#R2625 iCRT3 Sigma Aldrich Cat#SML0211 Doxycycline (Dox) Sigma Aldrich Cat#D9891 Phosphatase inhibitor Cocktail 2 Sigma Aldrich Cat# P5726 Phosphatase inhibitor Cocktail 3 Sigma Aldrich Cat# P0044 Protease inhibitor cocktail Sigma Aldrich Cat# P8340 Recombinant Murine LIF Peprotech Cat#250-02 Recombinant Human/Murine/Rat Activin A Peprotech Cat#120-14E Recombinant Human FGF-basic Peprotech Cat#100-18B Recombinant Human DKK-1 Peprotech Cat#120-30 Chorionic gonadotropin human Sigma Aldrich Cat#CG10-1VL Cook Blasto Cook Ireland Ltd, Ireland Cat# G46296 N2 Supplement Thermo Fisher Scientific Cat#17502048 B27 Supplement Thermo Fisher Scientific Cat12587010 Neurobasal Gibco Cat#21103-049 DMEM/F12 Gibco Cat#11320-074 DMEM Gibco Cat#41965–039 Knockout DMEM Gibco Cat#10829-018 Knockout serum replacement Gibco Cat#10828-028 Normal Donkey serum Jackson ImmunoResearch Cat#017-000-121, RRID:AB_2337258 Human Plasma Fibronectin Millipore Cat#FC010 EmbryoMax 0.1% Gelatin Solution Sigma Aldrich Cat#ES-006-B Accutase solution Sigma Aldrich Cat#A6964 Trypsin 0.05% Gibco Cat#25300-054 Cell Dissociation Solution Sigma Aldrich Cat#C5914 EmbryoMax® M2 Medium Sigma Aldrich Cat#MR-015-D EmbryoMax® KSOM Mouse Embryo Media Sigma Aldrich Cat#MR-121-D RIPA buffer Sigma Aldrich Cat#R0278 .. GenEluteTM Mammalian Total RNA Miniprep Kit Sigma Aldrich Cat#RTN350 On-Column DNase I Digestion Set Sigma Aldrich Cat#DNASE70 iScriptTM cDNA Synthesis Kit Bio-Rad Cat#1708890 Arcturus® PicoPure® DNA Extraction Kit Thermo Fisher Scientific Cat#KIT0103 KAPA Stranded RNA-Seq Library Preparation Kit Illumina® Platforms Roche Cat#7962207001 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#Q32854
Transfection:Article Title: CD44 correlates with longevity and enhances basal ATF6 activity and ER stress resistance.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-A2B5 antibody R&D systems Cat#MAB1416; RRID:AB_357687 Anti-Olig2 antibody Abcam Cat#ab109186; RRID:AB_10861310 Anti-Sox10 antibody Abcam Cat#ab180862; RRID:AB_2721184 Anti-CD44 antibody Proteintech Cat#15675-1-AP; RRID:AB_2919823 Anti-CD44 antibody Abcam Cat#ab157107; RRID:AB_2847859 Anti-CD44 antibody BD Biosciences Cat#558739; RRID:AB_397098 Anti-LDLR antibody R&D systems Cat#AF2255; RRID:AB_355203 Anti-ERp57 antibody SantaCruz Cat#sc-23886; RRID:AB_2160864 Anti-HSP47 antibody SantaCruz Cat#sc-5293; RRID:AB_627757 Anti-RPN2 antibody SantaCruz Cat#sc-166421; RRID:AB_2238716 Anti-mtTFA antibody SantaCruz Cat#sc-376672; RRID:AB_11150497 Anti-GFP antibody MBL Cat#598; RRID:AB_591819 Anti-58K Golgi protein antibody Abcam Cat#ab27043; RRID:AB_2107005 Anti-ATF4 antibody Cell Signaling Cat#11815; RRID:AB_2616025 Anti-ATF6 antibody Cell Signaling Cat#65880; RRID:AB_2799696 Anti-ATF6 antibody Proteintech Cat#24169-1-AP; RRID:AB_2876891 Anti-ATF6 antibody Proteintech Cat#66563-1-Ig; RRID:AB_2881924 Anti-CALR antibody SantaCruz Cat#sc-166837; RRID:AB_2259561 Anti-EGFR antibody Cell Signaling Cat#4267; RRID:AB_2246311 Anti-HSPA5 antibody Proteintech Cat#11587-1-AP; RRID:AB_2119855 Anti-IRE1 antibody SantaCruz Cat#sc-390960; RRID:AB_2927490 Anti-PERK antibody SantaCruz Cat#sc-377400; RRID:AB_2762850 Anti-SEC62 antibody GeneTex Cat#GTX129853; RRID:AB_2886110 Anti-COL6A3 antibody SantaCruz Cat#sc-515335; RRID:AB_2943675 Anti-b-Actin antibody SantaCruz Cat#sc-47778; RRID:AB_626632 Anti-Vinculin antibody Sigma Cat#V9131; RRID:AB_477629 Normal rabbit IgG Cell Signaling Cat#2729; RRID:AB_1031062 Normal rat IgG antibody BD Biosciences Cat#559072; RRID:AB_397192 Alexa Fluor 488-conjugated anti-CD44 antibody BioLegend Cat#103016; RRID:AB_493679 Chemicals, peptides, and recombinant proteins Tunicamycin Sigma Cat#SML1287 Thapsigargin Wako Cat#209-17281 tBHP Tokyo Chemical Industry Cat#B3153 HA15 Sigma Cat#SML2118 4m8C Cayman Cat#CAY-22110 GSK2606414 Cayman Cat#CAY-17376 PF429242 Cayman Cat#CAY-15140 SCH772984 MedChemExpress Cat#HY-50846 SB202190 MedChemExpress; Cat#HY-10295 Streptomyces hyaluronidase Sigma Cat#H1136 Oligo-HA Echelon Cat#HYA-NANO5 50 kDa-HA Echelon Cat#HYA-50KEF (Continued on next page) 16 Cell Reports 42, 113130, September 26, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 500 kDa-HA Echelon Cat#HYA-500KEF 1000 kDa-HA Echelon Cat#HYA-1000KEF FGF-b Peprotech Cat#100-18B PDGF-AA Sigma Cat#H8291 N2 supplement Thermo Fisher Scientific Cat#17502048 B27 supplement Thermo Fisher Scientific Cat17504044 0.01% poly-L-ornithine solution Sigma Cat#A-0040-C Laminin Sigma Cat#L2020 Accutase Innovative Cell Technologies Cat#AT104 Insulin Sigma Cat#91077 T3 Sigma Cat#T2877 Liberase TM Sigma Cat#5401119001 PEI-MAX transfection reagent Polysciences Inc Cat#24765 RNAiMAX transfection reagent Thermo Fisher Scientific Cat#13778075 Protease inhibitor cocktail Nacalai Tesque Cat#04080-11 CellRox Deep Red Thermo Fisher Scientific Cat#C10422 Critical commercial assays CyQUANT Cell Proliferation Assay kit Thermo Fisher Scientific Cat#C7026 Neural Tissue Dissociation Kit Miltenyi Biotech Cat#130-092-628 Deposited data RNA-Seq, NMR OPCs https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9160 RNA-Seq, NMR OPCs transfected with siLuc or siCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9166 RNA-Seq, IMR90-hTert cells expressing shLuc or shCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-12936 RNA-Seq, human OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE181404 RNA-Seq, mouse OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE79244 RNA-Seq, rat OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE72739 RNA-Seq, NMR whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE67542 RNA-Seq, human whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE120795 RNA-Seq, mouse whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE96644 RNA-Seq, rat whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE53960 RNA-Seq, IMR90 cells overexpressing CD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-8943 Mass spectrometry, proteins co-immunoprecipitated with CD44 in IMR90 cells https://www.ebi.ac.uk/pride/ PXD013445 Experimental models: Cell lines IMR90 Japanese Collection of Research Bioresources Cat#JCRB9054 U2OS ATCC Cat#HTB-96 HEK293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains Naked Mole Rat Our lab N/A C57BL/6J mouse The Jackson Laboratory N/A Oligonucleotides Please see Table S5 for sequences of PCR primers, siRNAs, shRNAs, and gRNAs. .. This paper N/A Recombinant DNA pCGN-ATF6 Zhu et al.67 Addgene (#11974) pEGFP-ATF6-(S1P-) Chen et al.52 Addgene (#32956) (Continued on next page) Cell Reports 42, 113130, September 26, 2023 17
Protease Inhibitor:Article Title: CD44 correlates with longevity and enhances basal ATF6 activity and ER stress resistance.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-A2B5 antibody R&D systems Cat#MAB1416; RRID:AB_357687 Anti-Olig2 antibody Abcam Cat#ab109186; RRID:AB_10861310 Anti-Sox10 antibody Abcam Cat#ab180862; RRID:AB_2721184 Anti-CD44 antibody Proteintech Cat#15675-1-AP; RRID:AB_2919823 Anti-CD44 antibody Abcam Cat#ab157107; RRID:AB_2847859 Anti-CD44 antibody BD Biosciences Cat#558739; RRID:AB_397098 Anti-LDLR antibody R&D systems Cat#AF2255; RRID:AB_355203 Anti-ERp57 antibody SantaCruz Cat#sc-23886; RRID:AB_2160864 Anti-HSP47 antibody SantaCruz Cat#sc-5293; RRID:AB_627757 Anti-RPN2 antibody SantaCruz Cat#sc-166421; RRID:AB_2238716 Anti-mtTFA antibody SantaCruz Cat#sc-376672; RRID:AB_11150497 Anti-GFP antibody MBL Cat#598; RRID:AB_591819 Anti-58K Golgi protein antibody Abcam Cat#ab27043; RRID:AB_2107005 Anti-ATF4 antibody Cell Signaling Cat#11815; RRID:AB_2616025 Anti-ATF6 antibody Cell Signaling Cat#65880; RRID:AB_2799696 Anti-ATF6 antibody Proteintech Cat#24169-1-AP; RRID:AB_2876891 Anti-ATF6 antibody Proteintech Cat#66563-1-Ig; RRID:AB_2881924 Anti-CALR antibody SantaCruz Cat#sc-166837; RRID:AB_2259561 Anti-EGFR antibody Cell Signaling Cat#4267; RRID:AB_2246311 Anti-HSPA5 antibody Proteintech Cat#11587-1-AP; RRID:AB_2119855 Anti-IRE1 antibody SantaCruz Cat#sc-390960; RRID:AB_2927490 Anti-PERK antibody SantaCruz Cat#sc-377400; RRID:AB_2762850 Anti-SEC62 antibody GeneTex Cat#GTX129853; RRID:AB_2886110 Anti-COL6A3 antibody SantaCruz Cat#sc-515335; RRID:AB_2943675 Anti-b-Actin antibody SantaCruz Cat#sc-47778; RRID:AB_626632 Anti-Vinculin antibody Sigma Cat#V9131; RRID:AB_477629 Normal rabbit IgG Cell Signaling Cat#2729; RRID:AB_1031062 Normal rat IgG antibody BD Biosciences Cat#559072; RRID:AB_397192 Alexa Fluor 488-conjugated anti-CD44 antibody BioLegend Cat#103016; RRID:AB_493679 Chemicals, peptides, and recombinant proteins Tunicamycin Sigma Cat#SML1287 Thapsigargin Wako Cat#209-17281 tBHP Tokyo Chemical Industry Cat#B3153 HA15 Sigma Cat#SML2118 4m8C Cayman Cat#CAY-22110 GSK2606414 Cayman Cat#CAY-17376 PF429242 Cayman Cat#CAY-15140 SCH772984 MedChemExpress Cat#HY-50846 SB202190 MedChemExpress; Cat#HY-10295 Streptomyces hyaluronidase Sigma Cat#H1136 Oligo-HA Echelon Cat#HYA-NANO5 50 kDa-HA Echelon Cat#HYA-50KEF (Continued on next page) 16 Cell Reports 42, 113130, September 26, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 500 kDa-HA Echelon Cat#HYA-500KEF 1000 kDa-HA Echelon Cat#HYA-1000KEF FGF-b Peprotech Cat#100-18B PDGF-AA Sigma Cat#H8291 N2 supplement Thermo Fisher Scientific Cat#17502048 B27 supplement Thermo Fisher Scientific Cat17504044 0.01% poly-L-ornithine solution Sigma Cat#A-0040-C Laminin Sigma Cat#L2020 Accutase Innovative Cell Technologies Cat#AT104 Insulin Sigma Cat#91077 T3 Sigma Cat#T2877 Liberase TM Sigma Cat#5401119001 PEI-MAX transfection reagent Polysciences Inc Cat#24765 RNAiMAX transfection reagent Thermo Fisher Scientific Cat#13778075 Protease inhibitor cocktail Nacalai Tesque Cat#04080-11 CellRox Deep Red Thermo Fisher Scientific Cat#C10422 Critical commercial assays CyQUANT Cell Proliferation Assay kit Thermo Fisher Scientific Cat#C7026 Neural Tissue Dissociation Kit Miltenyi Biotech Cat#130-092-628 Deposited data RNA-Seq, NMR OPCs https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9160 RNA-Seq, NMR OPCs transfected with siLuc or siCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9166 RNA-Seq, IMR90-hTert cells expressing shLuc or shCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-12936 RNA-Seq, human OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE181404 RNA-Seq, mouse OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE79244 RNA-Seq, rat OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE72739 RNA-Seq, NMR whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE67542 RNA-Seq, human whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE120795 RNA-Seq, mouse whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE96644 RNA-Seq, rat whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE53960 RNA-Seq, IMR90 cells overexpressing CD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-8943 Mass spectrometry, proteins co-immunoprecipitated with CD44 in IMR90 cells https://www.ebi.ac.uk/pride/ PXD013445 Experimental models: Cell lines IMR90 Japanese Collection of Research Bioresources Cat#JCRB9054 U2OS ATCC Cat#HTB-96 HEK293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains Naked Mole Rat Our lab N/A C57BL/6J mouse The Jackson Laboratory N/A Oligonucleotides Please see Table S5 for sequences of PCR primers, siRNAs, shRNAs, and gRNAs. .. This paper N/A Recombinant DNA pCGN-ATF6 Zhu et al.67 Addgene (#11974) pEGFP-ATF6-(S1P-) Chen et al.52 Addgene (#32956) (Continued on next page) Cell Reports 42, 113130, September 26, 2023 17
Article Title: The Wnt/TCF7L1 transcriptional repressor axis drives primitive endoderm formation by antagonizing naive and formative pluripotency
Article Snippet: R35-95 (RUO) BD Biosciences Cat#553930, RRID:AB_479719 APC Rat IgG2α, κ Isotype (eBR2a) Thermo Fisher Scientific Cat#17-4321-81, RRID:AB_470181 Supplementary Table 2: Reagents and resources .. XAV939 Sigma Aldrich Cat#X3004 PD0325901 Sigma Aldrich Cat#PZ0162 CHIR99021 Sigma Aldrich Cat#SML1046 Retinoic acid Sigma Aldrich Cat#R2625 iCRT3 Sigma Aldrich Cat#SML0211 Doxycycline (Dox) Sigma Aldrich Cat#D9891 Phosphatase inhibitor Cocktail 2 Sigma Aldrich Cat# P5726 Phosphatase inhibitor Cocktail 3 Sigma Aldrich Cat# P0044 Protease inhibitor cocktail Sigma Aldrich Cat# P8340 Recombinant Murine LIF Peprotech Cat#250-02 Recombinant Human/Murine/Rat Activin A Peprotech Cat#120-14E Recombinant Human FGF-basic Peprotech Cat#100-18B Recombinant Human DKK-1 Peprotech Cat#120-30 Chorionic gonadotropin human Sigma Aldrich Cat#CG10-1VL Cook Blasto Cook Ireland Ltd, Ireland Cat# G46296 N2 Supplement Thermo Fisher Scientific Cat#17502048 B27 Supplement Thermo Fisher Scientific Cat12587010 Neurobasal Gibco Cat#21103-049 DMEM/F12 Gibco Cat#11320-074 DMEM Gibco Cat#41965–039 Knockout DMEM Gibco Cat#10829-018 Knockout serum replacement Gibco Cat#10828-028 Normal Donkey serum Jackson ImmunoResearch Cat#017-000-121, RRID:AB_2337258 Human Plasma Fibronectin Millipore Cat#FC010 EmbryoMax 0.1% Gelatin Solution Sigma Aldrich Cat#ES-006-B Accutase solution Sigma Aldrich Cat#A6964 Trypsin 0.05% Gibco Cat#25300-054 Cell Dissociation Solution Sigma Aldrich Cat#C5914 EmbryoMax® M2 Medium Sigma Aldrich Cat#MR-015-D EmbryoMax® KSOM Mouse Embryo Media Sigma Aldrich Cat#MR-121-D RIPA buffer Sigma Aldrich Cat#R0278 .. GenEluteTM Mammalian Total RNA Miniprep Kit Sigma Aldrich Cat#RTN350 On-Column DNase I Digestion Set Sigma Aldrich Cat#DNASE70 iScriptTM cDNA Synthesis Kit Bio-Rad Cat#1708890 Arcturus® PicoPure® DNA Extraction Kit Thermo Fisher Scientific Cat#KIT0103 KAPA Stranded RNA-Seq Library Preparation Kit Illumina® Platforms Roche Cat#7962207001 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#Q32854
CyQUANT Assay:Article Title: CD44 correlates with longevity and enhances basal ATF6 activity and ER stress resistance.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-A2B5 antibody R&D systems Cat#MAB1416; RRID:AB_357687 Anti-Olig2 antibody Abcam Cat#ab109186; RRID:AB_10861310 Anti-Sox10 antibody Abcam Cat#ab180862; RRID:AB_2721184 Anti-CD44 antibody Proteintech Cat#15675-1-AP; RRID:AB_2919823 Anti-CD44 antibody Abcam Cat#ab157107; RRID:AB_2847859 Anti-CD44 antibody BD Biosciences Cat#558739; RRID:AB_397098 Anti-LDLR antibody R&D systems Cat#AF2255; RRID:AB_355203 Anti-ERp57 antibody SantaCruz Cat#sc-23886; RRID:AB_2160864 Anti-HSP47 antibody SantaCruz Cat#sc-5293; RRID:AB_627757 Anti-RPN2 antibody SantaCruz Cat#sc-166421; RRID:AB_2238716 Anti-mtTFA antibody SantaCruz Cat#sc-376672; RRID:AB_11150497 Anti-GFP antibody MBL Cat#598; RRID:AB_591819 Anti-58K Golgi protein antibody Abcam Cat#ab27043; RRID:AB_2107005 Anti-ATF4 antibody Cell Signaling Cat#11815; RRID:AB_2616025 Anti-ATF6 antibody Cell Signaling Cat#65880; RRID:AB_2799696 Anti-ATF6 antibody Proteintech Cat#24169-1-AP; RRID:AB_2876891 Anti-ATF6 antibody Proteintech Cat#66563-1-Ig; RRID:AB_2881924 Anti-CALR antibody SantaCruz Cat#sc-166837; RRID:AB_2259561 Anti-EGFR antibody Cell Signaling Cat#4267; RRID:AB_2246311 Anti-HSPA5 antibody Proteintech Cat#11587-1-AP; RRID:AB_2119855 Anti-IRE1 antibody SantaCruz Cat#sc-390960; RRID:AB_2927490 Anti-PERK antibody SantaCruz Cat#sc-377400; RRID:AB_2762850 Anti-SEC62 antibody GeneTex Cat#GTX129853; RRID:AB_2886110 Anti-COL6A3 antibody SantaCruz Cat#sc-515335; RRID:AB_2943675 Anti-b-Actin antibody SantaCruz Cat#sc-47778; RRID:AB_626632 Anti-Vinculin antibody Sigma Cat#V9131; RRID:AB_477629 Normal rabbit IgG Cell Signaling Cat#2729; RRID:AB_1031062 Normal rat IgG antibody BD Biosciences Cat#559072; RRID:AB_397192 Alexa Fluor 488-conjugated anti-CD44 antibody BioLegend Cat#103016; RRID:AB_493679 Chemicals, peptides, and recombinant proteins Tunicamycin Sigma Cat#SML1287 Thapsigargin Wako Cat#209-17281 tBHP Tokyo Chemical Industry Cat#B3153 HA15 Sigma Cat#SML2118 4m8C Cayman Cat#CAY-22110 GSK2606414 Cayman Cat#CAY-17376 PF429242 Cayman Cat#CAY-15140 SCH772984 MedChemExpress Cat#HY-50846 SB202190 MedChemExpress; Cat#HY-10295 Streptomyces hyaluronidase Sigma Cat#H1136 Oligo-HA Echelon Cat#HYA-NANO5 50 kDa-HA Echelon Cat#HYA-50KEF (Continued on next page) 16 Cell Reports 42, 113130, September 26, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 500 kDa-HA Echelon Cat#HYA-500KEF 1000 kDa-HA Echelon Cat#HYA-1000KEF FGF-b Peprotech Cat#100-18B PDGF-AA Sigma Cat#H8291 N2 supplement Thermo Fisher Scientific Cat#17502048 B27 supplement Thermo Fisher Scientific Cat17504044 0.01% poly-L-ornithine solution Sigma Cat#A-0040-C Laminin Sigma Cat#L2020 Accutase Innovative Cell Technologies Cat#AT104 Insulin Sigma Cat#91077 T3 Sigma Cat#T2877 Liberase TM Sigma Cat#5401119001 PEI-MAX transfection reagent Polysciences Inc Cat#24765 RNAiMAX transfection reagent Thermo Fisher Scientific Cat#13778075 Protease inhibitor cocktail Nacalai Tesque Cat#04080-11 CellRox Deep Red Thermo Fisher Scientific Cat#C10422 Critical commercial assays CyQUANT Cell Proliferation Assay kit Thermo Fisher Scientific Cat#C7026 Neural Tissue Dissociation Kit Miltenyi Biotech Cat#130-092-628 Deposited data RNA-Seq, NMR OPCs https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9160 RNA-Seq, NMR OPCs transfected with siLuc or siCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9166 RNA-Seq, IMR90-hTert cells expressing shLuc or shCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-12936 RNA-Seq, human OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE181404 RNA-Seq, mouse OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE79244 RNA-Seq, rat OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE72739 RNA-Seq, NMR whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE67542 RNA-Seq, human whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE120795 RNA-Seq, mouse whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE96644 RNA-Seq, rat whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE53960 RNA-Seq, IMR90 cells overexpressing CD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-8943 Mass spectrometry, proteins co-immunoprecipitated with CD44 in IMR90 cells https://www.ebi.ac.uk/pride/ PXD013445 Experimental models: Cell lines IMR90 Japanese Collection of Research Bioresources Cat#JCRB9054 U2OS ATCC Cat#HTB-96 HEK293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains Naked Mole Rat Our lab N/A C57BL/6J mouse The Jackson Laboratory N/A Oligonucleotides Please see Table S5 for sequences of PCR primers, siRNAs, shRNAs, and gRNAs. .. This paper N/A Recombinant DNA pCGN-ATF6 Zhu et al.67 Addgene (#11974) pEGFP-ATF6-(S1P-) Chen et al.52 Addgene (#32956) (Continued on next page) Cell Reports 42, 113130, September 26, 2023 17
Proliferation Assay:Article Title: CD44 correlates with longevity and enhances basal ATF6 activity and ER stress resistance.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-A2B5 antibody R&D systems Cat#MAB1416; RRID:AB_357687 Anti-Olig2 antibody Abcam Cat#ab109186; RRID:AB_10861310 Anti-Sox10 antibody Abcam Cat#ab180862; RRID:AB_2721184 Anti-CD44 antibody Proteintech Cat#15675-1-AP; RRID:AB_2919823 Anti-CD44 antibody Abcam Cat#ab157107; RRID:AB_2847859 Anti-CD44 antibody BD Biosciences Cat#558739; RRID:AB_397098 Anti-LDLR antibody R&D systems Cat#AF2255; RRID:AB_355203 Anti-ERp57 antibody SantaCruz Cat#sc-23886; RRID:AB_2160864 Anti-HSP47 antibody SantaCruz Cat#sc-5293; RRID:AB_627757 Anti-RPN2 antibody SantaCruz Cat#sc-166421; RRID:AB_2238716 Anti-mtTFA antibody SantaCruz Cat#sc-376672; RRID:AB_11150497 Anti-GFP antibody MBL Cat#598; RRID:AB_591819 Anti-58K Golgi protein antibody Abcam Cat#ab27043; RRID:AB_2107005 Anti-ATF4 antibody Cell Signaling Cat#11815; RRID:AB_2616025 Anti-ATF6 antibody Cell Signaling Cat#65880; RRID:AB_2799696 Anti-ATF6 antibody Proteintech Cat#24169-1-AP; RRID:AB_2876891 Anti-ATF6 antibody Proteintech Cat#66563-1-Ig; RRID:AB_2881924 Anti-CALR antibody SantaCruz Cat#sc-166837; RRID:AB_2259561 Anti-EGFR antibody Cell Signaling Cat#4267; RRID:AB_2246311 Anti-HSPA5 antibody Proteintech Cat#11587-1-AP; RRID:AB_2119855 Anti-IRE1 antibody SantaCruz Cat#sc-390960; RRID:AB_2927490 Anti-PERK antibody SantaCruz Cat#sc-377400; RRID:AB_2762850 Anti-SEC62 antibody GeneTex Cat#GTX129853; RRID:AB_2886110 Anti-COL6A3 antibody SantaCruz Cat#sc-515335; RRID:AB_2943675 Anti-b-Actin antibody SantaCruz Cat#sc-47778; RRID:AB_626632 Anti-Vinculin antibody Sigma Cat#V9131; RRID:AB_477629 Normal rabbit IgG Cell Signaling Cat#2729; RRID:AB_1031062 Normal rat IgG antibody BD Biosciences Cat#559072; RRID:AB_397192 Alexa Fluor 488-conjugated anti-CD44 antibody BioLegend Cat#103016; RRID:AB_493679 Chemicals, peptides, and recombinant proteins Tunicamycin Sigma Cat#SML1287 Thapsigargin Wako Cat#209-17281 tBHP Tokyo Chemical Industry Cat#B3153 HA15 Sigma Cat#SML2118 4m8C Cayman Cat#CAY-22110 GSK2606414 Cayman Cat#CAY-17376 PF429242 Cayman Cat#CAY-15140 SCH772984 MedChemExpress Cat#HY-50846 SB202190 MedChemExpress; Cat#HY-10295 Streptomyces hyaluronidase Sigma Cat#H1136 Oligo-HA Echelon Cat#HYA-NANO5 50 kDa-HA Echelon Cat#HYA-50KEF (Continued on next page) 16 Cell Reports 42, 113130, September 26, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 500 kDa-HA Echelon Cat#HYA-500KEF 1000 kDa-HA Echelon Cat#HYA-1000KEF FGF-b Peprotech Cat#100-18B PDGF-AA Sigma Cat#H8291 N2 supplement Thermo Fisher Scientific Cat#17502048 B27 supplement Thermo Fisher Scientific Cat17504044 0.01% poly-L-ornithine solution Sigma Cat#A-0040-C Laminin Sigma Cat#L2020 Accutase Innovative Cell Technologies Cat#AT104 Insulin Sigma Cat#91077 T3 Sigma Cat#T2877 Liberase TM Sigma Cat#5401119001 PEI-MAX transfection reagent Polysciences Inc Cat#24765 RNAiMAX transfection reagent Thermo Fisher Scientific Cat#13778075 Protease inhibitor cocktail Nacalai Tesque Cat#04080-11 CellRox Deep Red Thermo Fisher Scientific Cat#C10422 Critical commercial assays CyQUANT Cell Proliferation Assay kit Thermo Fisher Scientific Cat#C7026 Neural Tissue Dissociation Kit Miltenyi Biotech Cat#130-092-628 Deposited data RNA-Seq, NMR OPCs https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9160 RNA-Seq, NMR OPCs transfected with siLuc or siCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9166 RNA-Seq, IMR90-hTert cells expressing shLuc or shCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-12936 RNA-Seq, human OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE181404 RNA-Seq, mouse OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE79244 RNA-Seq, rat OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE72739 RNA-Seq, NMR whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE67542 RNA-Seq, human whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE120795 RNA-Seq, mouse whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE96644 RNA-Seq, rat whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE53960 RNA-Seq, IMR90 cells overexpressing CD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-8943 Mass spectrometry, proteins co-immunoprecipitated with CD44 in IMR90 cells https://www.ebi.ac.uk/pride/ PXD013445 Experimental models: Cell lines IMR90 Japanese Collection of Research Bioresources Cat#JCRB9054 U2OS ATCC Cat#HTB-96 HEK293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains Naked Mole Rat Our lab N/A C57BL/6J mouse The Jackson Laboratory N/A Oligonucleotides Please see Table S5 for sequences of PCR primers, siRNAs, shRNAs, and gRNAs. .. This paper N/A Recombinant DNA pCGN-ATF6 Zhu et al.67 Addgene (#11974) pEGFP-ATF6-(S1P-) Chen et al.52 Addgene (#32956) (Continued on next page) Cell Reports 42, 113130, September 26, 2023 17
Nuclear Magnetic Resonance:Article Title: CD44 correlates with longevity and enhances basal ATF6 activity and ER stress resistance.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-A2B5 antibody R&D systems Cat#MAB1416; RRID:AB_357687 Anti-Olig2 antibody Abcam Cat#ab109186; RRID:AB_10861310 Anti-Sox10 antibody Abcam Cat#ab180862; RRID:AB_2721184 Anti-CD44 antibody Proteintech Cat#15675-1-AP; RRID:AB_2919823 Anti-CD44 antibody Abcam Cat#ab157107; RRID:AB_2847859 Anti-CD44 antibody BD Biosciences Cat#558739; RRID:AB_397098 Anti-LDLR antibody R&D systems Cat#AF2255; RRID:AB_355203 Anti-ERp57 antibody SantaCruz Cat#sc-23886; RRID:AB_2160864 Anti-HSP47 antibody SantaCruz Cat#sc-5293; RRID:AB_627757 Anti-RPN2 antibody SantaCruz Cat#sc-166421; RRID:AB_2238716 Anti-mtTFA antibody SantaCruz Cat#sc-376672; RRID:AB_11150497 Anti-GFP antibody MBL Cat#598; RRID:AB_591819 Anti-58K Golgi protein antibody Abcam Cat#ab27043; RRID:AB_2107005 Anti-ATF4 antibody Cell Signaling Cat#11815; RRID:AB_2616025 Anti-ATF6 antibody Cell Signaling Cat#65880; RRID:AB_2799696 Anti-ATF6 antibody Proteintech Cat#24169-1-AP; RRID:AB_2876891 Anti-ATF6 antibody Proteintech Cat#66563-1-Ig; RRID:AB_2881924 Anti-CALR antibody SantaCruz Cat#sc-166837; RRID:AB_2259561 Anti-EGFR antibody Cell Signaling Cat#4267; RRID:AB_2246311 Anti-HSPA5 antibody Proteintech Cat#11587-1-AP; RRID:AB_2119855 Anti-IRE1 antibody SantaCruz Cat#sc-390960; RRID:AB_2927490 Anti-PERK antibody SantaCruz Cat#sc-377400; RRID:AB_2762850 Anti-SEC62 antibody GeneTex Cat#GTX129853; RRID:AB_2886110 Anti-COL6A3 antibody SantaCruz Cat#sc-515335; RRID:AB_2943675 Anti-b-Actin antibody SantaCruz Cat#sc-47778; RRID:AB_626632 Anti-Vinculin antibody Sigma Cat#V9131; RRID:AB_477629 Normal rabbit IgG Cell Signaling Cat#2729; RRID:AB_1031062 Normal rat IgG antibody BD Biosciences Cat#559072; RRID:AB_397192 Alexa Fluor 488-conjugated anti-CD44 antibody BioLegend Cat#103016; RRID:AB_493679 Chemicals, peptides, and recombinant proteins Tunicamycin Sigma Cat#SML1287 Thapsigargin Wako Cat#209-17281 tBHP Tokyo Chemical Industry Cat#B3153 HA15 Sigma Cat#SML2118 4m8C Cayman Cat#CAY-22110 GSK2606414 Cayman Cat#CAY-17376 PF429242 Cayman Cat#CAY-15140 SCH772984 MedChemExpress Cat#HY-50846 SB202190 MedChemExpress; Cat#HY-10295 Streptomyces hyaluronidase Sigma Cat#H1136 Oligo-HA Echelon Cat#HYA-NANO5 50 kDa-HA Echelon Cat#HYA-50KEF (Continued on next page) 16 Cell Reports 42, 113130, September 26, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 500 kDa-HA Echelon Cat#HYA-500KEF 1000 kDa-HA Echelon Cat#HYA-1000KEF FGF-b Peprotech Cat#100-18B PDGF-AA Sigma Cat#H8291 N2 supplement Thermo Fisher Scientific Cat#17502048 B27 supplement Thermo Fisher Scientific Cat17504044 0.01% poly-L-ornithine solution Sigma Cat#A-0040-C Laminin Sigma Cat#L2020 Accutase Innovative Cell Technologies Cat#AT104 Insulin Sigma Cat#91077 T3 Sigma Cat#T2877 Liberase TM Sigma Cat#5401119001 PEI-MAX transfection reagent Polysciences Inc Cat#24765 RNAiMAX transfection reagent Thermo Fisher Scientific Cat#13778075 Protease inhibitor cocktail Nacalai Tesque Cat#04080-11 CellRox Deep Red Thermo Fisher Scientific Cat#C10422 Critical commercial assays CyQUANT Cell Proliferation Assay kit Thermo Fisher Scientific Cat#C7026 Neural Tissue Dissociation Kit Miltenyi Biotech Cat#130-092-628 Deposited data RNA-Seq, NMR OPCs https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9160 RNA-Seq, NMR OPCs transfected with siLuc or siCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9166 RNA-Seq, IMR90-hTert cells expressing shLuc or shCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-12936 RNA-Seq, human OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE181404 RNA-Seq, mouse OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE79244 RNA-Seq, rat OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE72739 RNA-Seq, NMR whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE67542 RNA-Seq, human whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE120795 RNA-Seq, mouse whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE96644 RNA-Seq, rat whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE53960 RNA-Seq, IMR90 cells overexpressing CD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-8943 Mass spectrometry, proteins co-immunoprecipitated with CD44 in IMR90 cells https://www.ebi.ac.uk/pride/ PXD013445 Experimental models: Cell lines IMR90 Japanese Collection of Research Bioresources Cat#JCRB9054 U2OS ATCC Cat#HTB-96 HEK293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains Naked Mole Rat Our lab N/A C57BL/6J mouse The Jackson Laboratory N/A Oligonucleotides Please see Table S5 for sequences of PCR primers, siRNAs, shRNAs, and gRNAs. .. This paper N/A Recombinant DNA pCGN-ATF6 Zhu et al.67 Addgene (#11974) pEGFP-ATF6-(S1P-) Chen et al.52 Addgene (#32956) (Continued on next page) Cell Reports 42, 113130, September 26, 2023 17
Expressing:Article Title: CD44 correlates with longevity and enhances basal ATF6 activity and ER stress resistance.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-A2B5 antibody R&D systems Cat#MAB1416; RRID:AB_357687 Anti-Olig2 antibody Abcam Cat#ab109186; RRID:AB_10861310 Anti-Sox10 antibody Abcam Cat#ab180862; RRID:AB_2721184 Anti-CD44 antibody Proteintech Cat#15675-1-AP; RRID:AB_2919823 Anti-CD44 antibody Abcam Cat#ab157107; RRID:AB_2847859 Anti-CD44 antibody BD Biosciences Cat#558739; RRID:AB_397098 Anti-LDLR antibody R&D systems Cat#AF2255; RRID:AB_355203 Anti-ERp57 antibody SantaCruz Cat#sc-23886; RRID:AB_2160864 Anti-HSP47 antibody SantaCruz Cat#sc-5293; RRID:AB_627757 Anti-RPN2 antibody SantaCruz Cat#sc-166421; RRID:AB_2238716 Anti-mtTFA antibody SantaCruz Cat#sc-376672; RRID:AB_11150497 Anti-GFP antibody MBL Cat#598; RRID:AB_591819 Anti-58K Golgi protein antibody Abcam Cat#ab27043; RRID:AB_2107005 Anti-ATF4 antibody Cell Signaling Cat#11815; RRID:AB_2616025 Anti-ATF6 antibody Cell Signaling Cat#65880; RRID:AB_2799696 Anti-ATF6 antibody Proteintech Cat#24169-1-AP; RRID:AB_2876891 Anti-ATF6 antibody Proteintech Cat#66563-1-Ig; RRID:AB_2881924 Anti-CALR antibody SantaCruz Cat#sc-166837; RRID:AB_2259561 Anti-EGFR antibody Cell Signaling Cat#4267; RRID:AB_2246311 Anti-HSPA5 antibody Proteintech Cat#11587-1-AP; RRID:AB_2119855 Anti-IRE1 antibody SantaCruz Cat#sc-390960; RRID:AB_2927490 Anti-PERK antibody SantaCruz Cat#sc-377400; RRID:AB_2762850 Anti-SEC62 antibody GeneTex Cat#GTX129853; RRID:AB_2886110 Anti-COL6A3 antibody SantaCruz Cat#sc-515335; RRID:AB_2943675 Anti-b-Actin antibody SantaCruz Cat#sc-47778; RRID:AB_626632 Anti-Vinculin antibody Sigma Cat#V9131; RRID:AB_477629 Normal rabbit IgG Cell Signaling Cat#2729; RRID:AB_1031062 Normal rat IgG antibody BD Biosciences Cat#559072; RRID:AB_397192 Alexa Fluor 488-conjugated anti-CD44 antibody BioLegend Cat#103016; RRID:AB_493679 Chemicals, peptides, and recombinant proteins Tunicamycin Sigma Cat#SML1287 Thapsigargin Wako Cat#209-17281 tBHP Tokyo Chemical Industry Cat#B3153 HA15 Sigma Cat#SML2118 4m8C Cayman Cat#CAY-22110 GSK2606414 Cayman Cat#CAY-17376 PF429242 Cayman Cat#CAY-15140 SCH772984 MedChemExpress Cat#HY-50846 SB202190 MedChemExpress; Cat#HY-10295 Streptomyces hyaluronidase Sigma Cat#H1136 Oligo-HA Echelon Cat#HYA-NANO5 50 kDa-HA Echelon Cat#HYA-50KEF (Continued on next page) 16 Cell Reports 42, 113130, September 26, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 500 kDa-HA Echelon Cat#HYA-500KEF 1000 kDa-HA Echelon Cat#HYA-1000KEF FGF-b Peprotech Cat#100-18B PDGF-AA Sigma Cat#H8291 N2 supplement Thermo Fisher Scientific Cat#17502048 B27 supplement Thermo Fisher Scientific Cat17504044 0.01% poly-L-ornithine solution Sigma Cat#A-0040-C Laminin Sigma Cat#L2020 Accutase Innovative Cell Technologies Cat#AT104 Insulin Sigma Cat#91077 T3 Sigma Cat#T2877 Liberase TM Sigma Cat#5401119001 PEI-MAX transfection reagent Polysciences Inc Cat#24765 RNAiMAX transfection reagent Thermo Fisher Scientific Cat#13778075 Protease inhibitor cocktail Nacalai Tesque Cat#04080-11 CellRox Deep Red Thermo Fisher Scientific Cat#C10422 Critical commercial assays CyQUANT Cell Proliferation Assay kit Thermo Fisher Scientific Cat#C7026 Neural Tissue Dissociation Kit Miltenyi Biotech Cat#130-092-628 Deposited data RNA-Seq, NMR OPCs https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9160 RNA-Seq, NMR OPCs transfected with siLuc or siCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9166 RNA-Seq, IMR90-hTert cells expressing shLuc or shCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-12936 RNA-Seq, human OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE181404 RNA-Seq, mouse OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE79244 RNA-Seq, rat OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE72739 RNA-Seq, NMR whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE67542 RNA-Seq, human whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE120795 RNA-Seq, mouse whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE96644 RNA-Seq, rat whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE53960 RNA-Seq, IMR90 cells overexpressing CD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-8943 Mass spectrometry, proteins co-immunoprecipitated with CD44 in IMR90 cells https://www.ebi.ac.uk/pride/ PXD013445 Experimental models: Cell lines IMR90 Japanese Collection of Research Bioresources Cat#JCRB9054 U2OS ATCC Cat#HTB-96 HEK293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains Naked Mole Rat Our lab N/A C57BL/6J mouse The Jackson Laboratory N/A Oligonucleotides Please see Table S5 for sequences of PCR primers, siRNAs, shRNAs, and gRNAs. .. This paper N/A Recombinant DNA pCGN-ATF6 Zhu et al.67 Addgene (#11974) pEGFP-ATF6-(S1P-) Chen et al.52 Addgene (#32956) (Continued on next page) Cell Reports 42, 113130, September 26, 2023 17
Mass Spectrometry:Article Title: CD44 correlates with longevity and enhances basal ATF6 activity and ER stress resistance.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-A2B5 antibody R&D systems Cat#MAB1416; RRID:AB_357687 Anti-Olig2 antibody Abcam Cat#ab109186; RRID:AB_10861310 Anti-Sox10 antibody Abcam Cat#ab180862; RRID:AB_2721184 Anti-CD44 antibody Proteintech Cat#15675-1-AP; RRID:AB_2919823 Anti-CD44 antibody Abcam Cat#ab157107; RRID:AB_2847859 Anti-CD44 antibody BD Biosciences Cat#558739; RRID:AB_397098 Anti-LDLR antibody R&D systems Cat#AF2255; RRID:AB_355203 Anti-ERp57 antibody SantaCruz Cat#sc-23886; RRID:AB_2160864 Anti-HSP47 antibody SantaCruz Cat#sc-5293; RRID:AB_627757 Anti-RPN2 antibody SantaCruz Cat#sc-166421; RRID:AB_2238716 Anti-mtTFA antibody SantaCruz Cat#sc-376672; RRID:AB_11150497 Anti-GFP antibody MBL Cat#598; RRID:AB_591819 Anti-58K Golgi protein antibody Abcam Cat#ab27043; RRID:AB_2107005 Anti-ATF4 antibody Cell Signaling Cat#11815; RRID:AB_2616025 Anti-ATF6 antibody Cell Signaling Cat#65880; RRID:AB_2799696 Anti-ATF6 antibody Proteintech Cat#24169-1-AP; RRID:AB_2876891 Anti-ATF6 antibody Proteintech Cat#66563-1-Ig; RRID:AB_2881924 Anti-CALR antibody SantaCruz Cat#sc-166837; RRID:AB_2259561 Anti-EGFR antibody Cell Signaling Cat#4267; RRID:AB_2246311 Anti-HSPA5 antibody Proteintech Cat#11587-1-AP; RRID:AB_2119855 Anti-IRE1 antibody SantaCruz Cat#sc-390960; RRID:AB_2927490 Anti-PERK antibody SantaCruz Cat#sc-377400; RRID:AB_2762850 Anti-SEC62 antibody GeneTex Cat#GTX129853; RRID:AB_2886110 Anti-COL6A3 antibody SantaCruz Cat#sc-515335; RRID:AB_2943675 Anti-b-Actin antibody SantaCruz Cat#sc-47778; RRID:AB_626632 Anti-Vinculin antibody Sigma Cat#V9131; RRID:AB_477629 Normal rabbit IgG Cell Signaling Cat#2729; RRID:AB_1031062 Normal rat IgG antibody BD Biosciences Cat#559072; RRID:AB_397192 Alexa Fluor 488-conjugated anti-CD44 antibody BioLegend Cat#103016; RRID:AB_493679 Chemicals, peptides, and recombinant proteins Tunicamycin Sigma Cat#SML1287 Thapsigargin Wako Cat#209-17281 tBHP Tokyo Chemical Industry Cat#B3153 HA15 Sigma Cat#SML2118 4m8C Cayman Cat#CAY-22110 GSK2606414 Cayman Cat#CAY-17376 PF429242 Cayman Cat#CAY-15140 SCH772984 MedChemExpress Cat#HY-50846 SB202190 MedChemExpress; Cat#HY-10295 Streptomyces hyaluronidase Sigma Cat#H1136 Oligo-HA Echelon Cat#HYA-NANO5 50 kDa-HA Echelon Cat#HYA-50KEF (Continued on next page) 16 Cell Reports 42, 113130, September 26, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 500 kDa-HA Echelon Cat#HYA-500KEF 1000 kDa-HA Echelon Cat#HYA-1000KEF FGF-b Peprotech Cat#100-18B PDGF-AA Sigma Cat#H8291 N2 supplement Thermo Fisher Scientific Cat#17502048 B27 supplement Thermo Fisher Scientific Cat17504044 0.01% poly-L-ornithine solution Sigma Cat#A-0040-C Laminin Sigma Cat#L2020 Accutase Innovative Cell Technologies Cat#AT104 Insulin Sigma Cat#91077 T3 Sigma Cat#T2877 Liberase TM Sigma Cat#5401119001 PEI-MAX transfection reagent Polysciences Inc Cat#24765 RNAiMAX transfection reagent Thermo Fisher Scientific Cat#13778075 Protease inhibitor cocktail Nacalai Tesque Cat#04080-11 CellRox Deep Red Thermo Fisher Scientific Cat#C10422 Critical commercial assays CyQUANT Cell Proliferation Assay kit Thermo Fisher Scientific Cat#C7026 Neural Tissue Dissociation Kit Miltenyi Biotech Cat#130-092-628 Deposited data RNA-Seq, NMR OPCs https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9160 RNA-Seq, NMR OPCs transfected with siLuc or siCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9166 RNA-Seq, IMR90-hTert cells expressing shLuc or shCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-12936 RNA-Seq, human OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE181404 RNA-Seq, mouse OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE79244 RNA-Seq, rat OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE72739 RNA-Seq, NMR whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE67542 RNA-Seq, human whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE120795 RNA-Seq, mouse whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE96644 RNA-Seq, rat whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE53960 RNA-Seq, IMR90 cells overexpressing CD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-8943 Mass spectrometry, proteins co-immunoprecipitated with CD44 in IMR90 cells https://www.ebi.ac.uk/pride/ PXD013445 Experimental models: Cell lines IMR90 Japanese Collection of Research Bioresources Cat#JCRB9054 U2OS ATCC Cat#HTB-96 HEK293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains Naked Mole Rat Our lab N/A C57BL/6J mouse The Jackson Laboratory N/A Oligonucleotides Please see Table S5 for sequences of PCR primers, siRNAs, shRNAs, and gRNAs. .. This paper N/A Recombinant DNA pCGN-ATF6 Zhu et al.67 Addgene (#11974) pEGFP-ATF6-(S1P-) Chen et al.52 Addgene (#32956) (Continued on next page) Cell Reports 42, 113130, September 26, 2023 17
Polymerase Chain Reaction:Article Title: CD44 correlates with longevity and enhances basal ATF6 activity and ER stress resistance.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-A2B5 antibody R&D systems Cat#MAB1416; RRID:AB_357687 Anti-Olig2 antibody Abcam Cat#ab109186; RRID:AB_10861310 Anti-Sox10 antibody Abcam Cat#ab180862; RRID:AB_2721184 Anti-CD44 antibody Proteintech Cat#15675-1-AP; RRID:AB_2919823 Anti-CD44 antibody Abcam Cat#ab157107; RRID:AB_2847859 Anti-CD44 antibody BD Biosciences Cat#558739; RRID:AB_397098 Anti-LDLR antibody R&D systems Cat#AF2255; RRID:AB_355203 Anti-ERp57 antibody SantaCruz Cat#sc-23886; RRID:AB_2160864 Anti-HSP47 antibody SantaCruz Cat#sc-5293; RRID:AB_627757 Anti-RPN2 antibody SantaCruz Cat#sc-166421; RRID:AB_2238716 Anti-mtTFA antibody SantaCruz Cat#sc-376672; RRID:AB_11150497 Anti-GFP antibody MBL Cat#598; RRID:AB_591819 Anti-58K Golgi protein antibody Abcam Cat#ab27043; RRID:AB_2107005 Anti-ATF4 antibody Cell Signaling Cat#11815; RRID:AB_2616025 Anti-ATF6 antibody Cell Signaling Cat#65880; RRID:AB_2799696 Anti-ATF6 antibody Proteintech Cat#24169-1-AP; RRID:AB_2876891 Anti-ATF6 antibody Proteintech Cat#66563-1-Ig; RRID:AB_2881924 Anti-CALR antibody SantaCruz Cat#sc-166837; RRID:AB_2259561 Anti-EGFR antibody Cell Signaling Cat#4267; RRID:AB_2246311 Anti-HSPA5 antibody Proteintech Cat#11587-1-AP; RRID:AB_2119855 Anti-IRE1 antibody SantaCruz Cat#sc-390960; RRID:AB_2927490 Anti-PERK antibody SantaCruz Cat#sc-377400; RRID:AB_2762850 Anti-SEC62 antibody GeneTex Cat#GTX129853; RRID:AB_2886110 Anti-COL6A3 antibody SantaCruz Cat#sc-515335; RRID:AB_2943675 Anti-b-Actin antibody SantaCruz Cat#sc-47778; RRID:AB_626632 Anti-Vinculin antibody Sigma Cat#V9131; RRID:AB_477629 Normal rabbit IgG Cell Signaling Cat#2729; RRID:AB_1031062 Normal rat IgG antibody BD Biosciences Cat#559072; RRID:AB_397192 Alexa Fluor 488-conjugated anti-CD44 antibody BioLegend Cat#103016; RRID:AB_493679 Chemicals, peptides, and recombinant proteins Tunicamycin Sigma Cat#SML1287 Thapsigargin Wako Cat#209-17281 tBHP Tokyo Chemical Industry Cat#B3153 HA15 Sigma Cat#SML2118 4m8C Cayman Cat#CAY-22110 GSK2606414 Cayman Cat#CAY-17376 PF429242 Cayman Cat#CAY-15140 SCH772984 MedChemExpress Cat#HY-50846 SB202190 MedChemExpress; Cat#HY-10295 Streptomyces hyaluronidase Sigma Cat#H1136 Oligo-HA Echelon Cat#HYA-NANO5 50 kDa-HA Echelon Cat#HYA-50KEF (Continued on next page) 16 Cell Reports 42, 113130, September 26, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER 500 kDa-HA Echelon Cat#HYA-500KEF 1000 kDa-HA Echelon Cat#HYA-1000KEF FGF-b Peprotech Cat#100-18B PDGF-AA Sigma Cat#H8291 N2 supplement Thermo Fisher Scientific Cat#17502048 B27 supplement Thermo Fisher Scientific Cat17504044 0.01% poly-L-ornithine solution Sigma Cat#A-0040-C Laminin Sigma Cat#L2020 Accutase Innovative Cell Technologies Cat#AT104 Insulin Sigma Cat#91077 T3 Sigma Cat#T2877 Liberase TM Sigma Cat#5401119001 PEI-MAX transfection reagent Polysciences Inc Cat#24765 RNAiMAX transfection reagent Thermo Fisher Scientific Cat#13778075 Protease inhibitor cocktail Nacalai Tesque Cat#04080-11 CellRox Deep Red Thermo Fisher Scientific Cat#C10422 Critical commercial assays CyQUANT Cell Proliferation Assay kit Thermo Fisher Scientific Cat#C7026 Neural Tissue Dissociation Kit Miltenyi Biotech Cat#130-092-628 Deposited data RNA-Seq, NMR OPCs https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9160 RNA-Seq, NMR OPCs transfected with siLuc or siCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-9166 RNA-Seq, IMR90-hTert cells expressing shLuc or shCD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-12936 RNA-Seq, human OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE181404 RNA-Seq, mouse OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE79244 RNA-Seq, rat OPCs https://www.ncbi.nlm.nih.gov/geo/ GSE72739 RNA-Seq, NMR whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE67542 RNA-Seq, human whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE120795 RNA-Seq, mouse whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE96644 RNA-Seq, rat whole brain https://www.ncbi.nlm.nih.gov/geo/ GSE53960 RNA-Seq, IMR90 cells overexpressing CD44 https://www.ebi.ac.uk/biostudies/arrayexpress E-MTAB-8943 Mass spectrometry, proteins co-immunoprecipitated with CD44 in IMR90 cells https://www.ebi.ac.uk/pride/ PXD013445 Experimental models: Cell lines IMR90 Japanese Collection of Research Bioresources Cat#JCRB9054 U2OS ATCC Cat#HTB-96 HEK293T ATCC Cat#CRL-3216 Experimental models: Organisms/strains Naked Mole Rat Our lab N/A C57BL/6J mouse The Jackson Laboratory N/A Oligonucleotides Please see Table S5 for sequences of PCR primers, siRNAs, shRNAs, and gRNAs. .. This paper N/A Recombinant DNA pCGN-ATF6 Zhu et al.67 Addgene (#11974) pEGFP-ATF6-(S1P-) Chen et al.52 Addgene (#32956) (Continued on next page) Cell Reports 42, 113130, September 26, 2023 17
Clinical Proteomics:Article Title: The Wnt/TCF7L1 transcriptional repressor axis drives primitive endoderm formation by antagonizing naive and formative pluripotency
Article Snippet: R35-95 (RUO) BD Biosciences Cat#553930, RRID:AB_479719 APC Rat IgG2α, κ Isotype (eBR2a) Thermo Fisher Scientific Cat#17-4321-81, RRID:AB_470181 Supplementary Table 2: Reagents and resources .. XAV939 Sigma Aldrich Cat#X3004 PD0325901 Sigma Aldrich Cat#PZ0162 CHIR99021 Sigma Aldrich Cat#SML1046 Retinoic acid Sigma Aldrich Cat#R2625 iCRT3 Sigma Aldrich Cat#SML0211 Doxycycline (Dox) Sigma Aldrich Cat#D9891 Phosphatase inhibitor Cocktail 2 Sigma Aldrich Cat# P5726 Phosphatase inhibitor Cocktail 3 Sigma Aldrich Cat# P0044 Protease inhibitor cocktail Sigma Aldrich Cat# P8340 Recombinant Murine LIF Peprotech Cat#250-02 Recombinant Human/Murine/Rat Activin A Peprotech Cat#120-14E Recombinant Human FGF-basic Peprotech Cat#100-18B Recombinant Human DKK-1 Peprotech Cat#120-30 Chorionic gonadotropin human Sigma Aldrich Cat#CG10-1VL Cook Blasto Cook Ireland Ltd, Ireland Cat# G46296 N2 Supplement Thermo Fisher Scientific Cat#17502048 B27 Supplement Thermo Fisher Scientific Cat12587010 Neurobasal Gibco Cat#21103-049 DMEM/F12 Gibco Cat#11320-074 DMEM Gibco Cat#41965–039 Knockout DMEM Gibco Cat#10829-018 Knockout serum replacement Gibco Cat#10828-028 Normal Donkey serum Jackson ImmunoResearch Cat#017-000-121, RRID:AB_2337258 Human Plasma Fibronectin Millipore Cat#FC010 EmbryoMax 0.1% Gelatin Solution Sigma Aldrich Cat#ES-006-B Accutase solution Sigma Aldrich Cat#A6964 Trypsin 0.05% Gibco Cat#25300-054 Cell Dissociation Solution Sigma Aldrich Cat#C5914 EmbryoMax® M2 Medium Sigma Aldrich Cat#MR-015-D EmbryoMax® KSOM Mouse Embryo Media Sigma Aldrich Cat#MR-121-D RIPA buffer Sigma Aldrich Cat#R0278 .. GenEluteTM Mammalian Total RNA Miniprep Kit Sigma Aldrich Cat#RTN350 On-Column DNase I Digestion Set Sigma Aldrich Cat#DNASE70 iScriptTM cDNA Synthesis Kit Bio-Rad Cat#1708890 Arcturus® PicoPure® DNA Extraction Kit Thermo Fisher Scientific Cat#KIT0103 KAPA Stranded RNA-Seq Library Preparation Kit Illumina® Platforms Roche Cat#7962207001 Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat#Q32854
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 